Incidental Mutation 'R3118:Pak6'
ID263114
Institutional Source Beutler Lab
Gene Symbol Pak6
Ensembl Gene ENSMUSG00000074923
Gene Namep21 (RAC1) activated kinase 6
Synonyms
MMRRC Submission 040591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3118 (G1)
Quality Score199
Status Not validated
Chromosome2
Chromosomal Location118663303-118698020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118689741 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 71 (V71A)
Ref Sequence ENSEMBL: ENSMUSP00000106477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099557] [ENSMUST00000110853]
Predicted Effect probably damaging
Transcript: ENSMUST00000099557
AA Change: V71A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097153
Gene: ENSMUSG00000074923
AA Change: V71A

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110853
AA Change: V71A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106477
Gene: ENSMUSG00000074923
AA Change: V71A

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele do not exhibit any abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T G 13: 104,314,279 D323E possibly damaging Het
Ccdc125 T C 13: 100,690,319 V228A possibly damaging Het
Chrna2 A G 14: 66,150,993 I486V probably damaging Het
Cpxm1 T C 2: 130,393,573 T500A possibly damaging Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Cxcl1 T A 5: 90,891,595 probably null Het
Dab1 G A 4: 104,680,069 probably null Het
Ddx11 T A 17: 66,149,277 M751K probably damaging Het
Ece1 A G 4: 137,948,544 T410A probably benign Het
Eml5 C T 12: 98,865,494 V402I probably damaging Het
Fam241b A T 10: 62,108,856 *121R probably null Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Gpr149 A G 3: 62,595,022 V471A probably benign Het
Lemd3 A G 10: 120,947,251 S557P probably benign Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mmp7 T C 9: 7,697,692 Y243H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pira2 T A 7: 3,841,677 R452* probably null Het
Plxna1 A G 6: 89,356,976 S224P possibly damaging Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Prss12 A T 3: 123,505,327 T583S possibly damaging Het
Rgs10 T C 7: 128,403,231 E65G probably damaging Het
Rnf19a T A 15: 36,241,899 K665* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tbx15 T C 3: 99,352,154 I447T probably damaging Het
Tmem135 A G 7: 89,147,797 S364P probably benign Het
Ugt1a9 T C 1: 88,070,840 V4A probably benign Het
Zfp595 T C 13: 67,320,899 I95M probably benign Het
Other mutations in Pak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pak6 APN 2 118689845 missense possibly damaging 0.58
IGL00979:Pak6 APN 2 118696482 missense probably damaging 1.00
IGL01577:Pak6 APN 2 118693648 missense probably benign 0.00
IGL01928:Pak6 APN 2 118689864 missense probably damaging 1.00
IGL01951:Pak6 APN 2 118693260 missense probably benign
IGL02387:Pak6 APN 2 118693233 missense probably benign
IGL03302:Pak6 APN 2 118693303 missense probably benign
bedamned UTSW 2 118694007 splice site probably benign
bequeathed UTSW 2 118693522 missense probably damaging 0.96
R0126:Pak6 UTSW 2 118690332 missense possibly damaging 0.86
R0883:Pak6 UTSW 2 118693687 missense probably damaging 1.00
R1128:Pak6 UTSW 2 118696509 missense probably benign 0.00
R2073:Pak6 UTSW 2 118688851 missense probably damaging 1.00
R2508:Pak6 UTSW 2 118694569 nonsense probably null
R2920:Pak6 UTSW 2 118694007 splice site probably benign
R3689:Pak6 UTSW 2 118693440 nonsense probably null
R3762:Pak6 UTSW 2 118696477 missense probably damaging 0.99
R4589:Pak6 UTSW 2 118696540 missense probably damaging 1.00
R4976:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5119:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5206:Pak6 UTSW 2 118693303 missense probably benign
R5683:Pak6 UTSW 2 118693912 missense probably damaging 1.00
R7232:Pak6 UTSW 2 118693522 missense probably damaging 0.96
R7236:Pak6 UTSW 2 118693428 missense probably benign 0.26
R7292:Pak6 UTSW 2 118693591 missense possibly damaging 0.95
R7623:Pak6 UTSW 2 118694587 missense probably damaging 1.00
R7823:Pak6 UTSW 2 118695312 missense probably benign 0.02
R8190:Pak6 UTSW 2 118690097 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGTGCTGAGTTTGCCAG -3'
(R):5'- TACATATCGGGGTCAGCAGC -3'

Sequencing Primer
(F):5'- ATGTTGGACCCTAACCCTGAG -3'
(R):5'- GCCCACTGATCATCTCCCAG -3'
Posted On2015-02-05