Incidental Mutation 'R3118:Tbx15'
ID 263117
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms de, Tbx14, Tbx8
MMRRC Submission 040591-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.935) question?
Stock # R3118 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99240381-99354259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99352154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 447 (I447T)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect probably damaging
Transcript: ENSMUST00000029462
AA Change: I447T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: I447T

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T G 13: 104,314,279 D323E possibly damaging Het
Ccdc125 T C 13: 100,690,319 V228A possibly damaging Het
Chrna2 A G 14: 66,150,993 I486V probably damaging Het
Cpxm1 T C 2: 130,393,573 T500A possibly damaging Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Cxcl1 T A 5: 90,891,595 probably null Het
Dab1 G A 4: 104,680,069 probably null Het
Ddx11 T A 17: 66,149,277 M751K probably damaging Het
Ece1 A G 4: 137,948,544 T410A probably benign Het
Eml5 C T 12: 98,865,494 V402I probably damaging Het
Fam241b A T 10: 62,108,856 *121R probably null Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Gpr149 A G 3: 62,595,022 V471A probably benign Het
Lemd3 A G 10: 120,947,251 S557P probably benign Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mmp7 T C 9: 7,697,692 Y243H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pak6 T C 2: 118,689,741 V71A probably damaging Het
Pira2 T A 7: 3,841,677 R452* probably null Het
Plxna1 A G 6: 89,356,976 S224P possibly damaging Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Prss12 A T 3: 123,505,327 T583S possibly damaging Het
Rgs10 T C 7: 128,403,231 E65G probably damaging Het
Rnf19a T A 15: 36,241,899 K665* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tmem135 A G 7: 89,147,797 S364P probably benign Het
Ugt1a9 T C 1: 88,070,840 V4A probably benign Het
Zfp595 T C 13: 67,320,899 I95M probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99316246 missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99316228 missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99313042 missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99352484 missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99352510 missense probably benign 0.01
IGL03143:Tbx15 APN 3 99352198 missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99351980 missense probably benign 0.00
shin_guard UTSW 3 99352192 missense possibly damaging 0.90
Shortcut UTSW 3 99313073 nonsense probably null
R0012:Tbx15 UTSW 3 99352096 missense probably benign
R0109:Tbx15 UTSW 3 99351866 missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99352391 missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99316318 missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99316323 missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99351912 missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99351824 splice site probably null
R1762:Tbx15 UTSW 3 99351944 nonsense probably null
R1789:Tbx15 UTSW 3 99352246 nonsense probably null
R2167:Tbx15 UTSW 3 99326455 splice site probably benign
R2254:Tbx15 UTSW 3 99351874 missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99316356 splice site probably null
R2441:Tbx15 UTSW 3 99352511 missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99253893 intron probably benign
R4081:Tbx15 UTSW 3 99313054 missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99352367 missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99352267 missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99326384 missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99254074 missense probably benign 0.06
R4999:Tbx15 UTSW 3 99316333 missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99352046 missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99316284 missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99352192 missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99352564 missense probably benign
R5690:Tbx15 UTSW 3 99308850 missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99313086 missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6156:Tbx15 UTSW 3 99313115 critical splice donor site probably null
R6173:Tbx15 UTSW 3 99253887 nonsense probably null
R6596:Tbx15 UTSW 3 99352192 missense probably benign
R6680:Tbx15 UTSW 3 99313073 nonsense probably null
R6931:Tbx15 UTSW 3 99352151 missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99253938 missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99352570 missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99351989 missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99313060 missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99314903 missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99314769 missense probably benign 0.14
R9688:Tbx15 UTSW 3 99326392 missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99352331 missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99314835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCCCGAATACTTTCAATG -3'
(R):5'- AGAAGGCATTATAGGAGCTCTGC -3'

Sequencing Primer
(F):5'- CCGAATACTTTCAATGTGGGC -3'
(R):5'- AGCTCTGCTGCATGTGGC -3'
Posted On 2015-02-05