Incidental Mutation 'R3118:Prpf39'
ID 263132
Institutional Source Beutler Lab
Gene Symbol Prpf39
Ensembl Gene ENSMUSG00000035597
Gene Name pre-mRNA processing factor 39
Synonyms Srcs1
MMRRC Submission 040591-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock # R3118 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 65036333-65063386 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65057877 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 572 (V572A)
Ref Sequence ENSEMBL: ENSMUSP00000112953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021332] [ENSMUST00000120580] [ENSMUST00000129956] [ENSMUST00000220730] [ENSMUST00000221166] [ENSMUST00000221913] [ENSMUST00000223315]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021332
SMART Domains Protein: ENSMUSP00000021332
Gene: ENSMUSG00000020949

DomainStartEndE-ValueType
PDB:2KFV|A 1 73 2e-45 PDB
low complexity region 91 100 N/A INTRINSIC
Pfam:FKBP_C 121 221 3.9e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120580
AA Change: V572A

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112953
Gene: ENSMUSG00000035597
AA Change: V572A

DomainStartEndE-ValueType
HAT 107 139 3.71e-2 SMART
HAT 141 173 4.39e-4 SMART
HAT 181 216 2.07e0 SMART
HAT 218 251 1.36e2 SMART
low complexity region 277 290 N/A INTRINSIC
Blast:HAT 323 363 6e-18 BLAST
HAT 365 397 3.2e-6 SMART
HAT 398 431 3.21e1 SMART
HAT 505 537 3.63e1 SMART
low complexity region 645 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129956
SMART Domains Protein: ENSMUSP00000114713
Gene: ENSMUSG00000035597

DomainStartEndE-ValueType
Blast:HAT 107 139 7e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220729
Predicted Effect probably benign
Transcript: ENSMUST00000220730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220957
Predicted Effect probably benign
Transcript: ENSMUST00000220983
Predicted Effect probably benign
Transcript: ENSMUST00000221166
Predicted Effect probably benign
Transcript: ENSMUST00000221608
Predicted Effect probably benign
Transcript: ENSMUST00000221913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223167
Predicted Effect probably benign
Transcript: ENSMUST00000223315
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T G 13: 104,314,279 D323E possibly damaging Het
Ccdc125 T C 13: 100,690,319 V228A possibly damaging Het
Chrna2 A G 14: 66,150,993 I486V probably damaging Het
Cpxm1 T C 2: 130,393,573 T500A possibly damaging Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Cxcl1 T A 5: 90,891,595 probably null Het
Dab1 G A 4: 104,680,069 probably null Het
Ddx11 T A 17: 66,149,277 M751K probably damaging Het
Ece1 A G 4: 137,948,544 T410A probably benign Het
Eml5 C T 12: 98,865,494 V402I probably damaging Het
Fam241b A T 10: 62,108,856 *121R probably null Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Gpr149 A G 3: 62,595,022 V471A probably benign Het
Lemd3 A G 10: 120,947,251 S557P probably benign Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mmp7 T C 9: 7,697,692 Y243H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pak6 T C 2: 118,689,741 V71A probably damaging Het
Pira2 T A 7: 3,841,677 R452* probably null Het
Plxna1 A G 6: 89,356,976 S224P possibly damaging Het
Prss12 A T 3: 123,505,327 T583S possibly damaging Het
Rgs10 T C 7: 128,403,231 E65G probably damaging Het
Rnf19a T A 15: 36,241,899 K665* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tbx15 T C 3: 99,352,154 I447T probably damaging Het
Tmem135 A G 7: 89,147,797 S364P probably benign Het
Ugt1a9 T C 1: 88,070,840 V4A probably benign Het
Zfp595 T C 13: 67,320,899 I95M probably benign Het
Other mutations in Prpf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Prpf39 APN 12 65043263 missense probably damaging 0.99
IGL01025:Prpf39 APN 12 65042481 unclassified probably benign
IGL01323:Prpf39 APN 12 65042724 missense possibly damaging 0.70
IGL02346:Prpf39 APN 12 65057736 missense probably benign 0.02
IGL02966:Prpf39 APN 12 65042779 missense probably benign 0.45
IGL03189:Prpf39 APN 12 65043302 nonsense probably null
IGL03357:Prpf39 APN 12 65061437 unclassified probably benign
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0328:Prpf39 UTSW 12 65043371 splice site probably benign
R0549:Prpf39 UTSW 12 65056256 missense probably benign 0.05
R0840:Prpf39 UTSW 12 65048206 missense probably benign 0.21
R1248:Prpf39 UTSW 12 65053966 splice site probably benign
R1322:Prpf39 UTSW 12 65042662 missense possibly damaging 0.48
R1481:Prpf39 UTSW 12 65053314 missense probably damaging 1.00
R2209:Prpf39 UTSW 12 65057915 critical splice donor site probably null
R2232:Prpf39 UTSW 12 65044012 nonsense probably null
R2507:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2508:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2959:Prpf39 UTSW 12 65042523 missense probably damaging 1.00
R3117:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3980:Prpf39 UTSW 12 65061457 unclassified probably benign
R4407:Prpf39 UTSW 12 65056266 missense probably damaging 1.00
R4620:Prpf39 UTSW 12 65042563 missense probably benign
R4926:Prpf39 UTSW 12 65044056 missense possibly damaging 0.90
R5154:Prpf39 UTSW 12 65048277 missense probably benign 0.29
R6248:Prpf39 UTSW 12 65042754 missense probably damaging 1.00
R6334:Prpf39 UTSW 12 65042813 splice site probably null
R6614:Prpf39 UTSW 12 65042563 missense probably benign
R6749:Prpf39 UTSW 12 65056274 missense possibly damaging 0.94
R6944:Prpf39 UTSW 12 65042680 missense probably benign 0.03
R7023:Prpf39 UTSW 12 65053300 missense possibly damaging 0.94
R7503:Prpf39 UTSW 12 65053393 missense probably benign 0.04
R7532:Prpf39 UTSW 12 65053371 missense probably benign 0.00
R7608:Prpf39 UTSW 12 65053446 missense probably benign 0.41
R8286:Prpf39 UTSW 12 65056358 missense probably benign
R8439:Prpf39 UTSW 12 65055262 missense possibly damaging 0.95
R8787:Prpf39 UTSW 12 65042781 missense possibly damaging 0.95
R9101:Prpf39 UTSW 12 65043304 missense probably damaging 1.00
R9153:Prpf39 UTSW 12 65059897 missense probably damaging 0.99
R9448:Prpf39 UTSW 12 65061260 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCGCTATGTATGCACACTGACAAC -3'
(R):5'- AATTACCTCCACATGTTTAGTACAC -3'

Sequencing Primer
(F):5'- TGTATGCACACTGACAACATACACG -3'
(R):5'- ACATGAGTAAGCCTGGTTACCTGC -3'
Posted On 2015-02-05