Incidental Mutation 'R3118:Eml5'
ID 263133
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 040591-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R3118 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 98753064-98867743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98831753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 402 (V402I)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: V363I

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: V363I

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: V402I

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T G 13: 104,450,787 (GRCm39) D323E possibly damaging Het
Ccdc125 T C 13: 100,826,827 (GRCm39) V228A possibly damaging Het
Chrna2 A G 14: 66,388,442 (GRCm39) I486V probably damaging Het
Cpxm1 T C 2: 130,235,493 (GRCm39) T500A possibly damaging Het
Crebbp G A 16: 3,927,062 (GRCm39) R628C probably damaging Het
Cxcl1 T A 5: 91,039,454 (GRCm39) probably null Het
Dab1 G A 4: 104,537,266 (GRCm39) probably null Het
Ddx11 T A 17: 66,456,272 (GRCm39) M751K probably damaging Het
Ece1 A G 4: 137,675,855 (GRCm39) T410A probably benign Het
Fam241b A T 10: 61,944,635 (GRCm39) *121R probably null Het
Fras1 G A 5: 96,919,571 (GRCm39) A3595T probably damaging Het
Gpr149 A G 3: 62,502,443 (GRCm39) V471A probably benign Het
Lemd3 A G 10: 120,783,156 (GRCm39) S557P probably benign Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,068,962 (GRCm39) probably benign Het
Mmp7 T C 9: 7,697,693 (GRCm39) Y243H probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Pak6 T C 2: 118,520,222 (GRCm39) V71A probably damaging Het
Pira2 T A 7: 3,844,676 (GRCm39) R452* probably null Het
Plxna1 A G 6: 89,333,958 (GRCm39) S224P possibly damaging Het
Prpf39 T C 12: 65,104,651 (GRCm39) V572A possibly damaging Het
Prss12 A T 3: 123,298,976 (GRCm39) T583S possibly damaging Het
Rgs10 T C 7: 128,004,955 (GRCm39) E65G probably damaging Het
Rnf19a T A 15: 36,242,045 (GRCm39) K665* probably null Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Tbx15 T C 3: 99,259,470 (GRCm39) I447T probably damaging Het
Tmem135 A G 7: 88,797,005 (GRCm39) S364P probably benign Het
Ugt1a9 T C 1: 87,998,562 (GRCm39) V4A probably benign Het
Zfp595 T C 13: 67,468,963 (GRCm39) I95M probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98,839,468 (GRCm39) splice site probably benign
IGL00473:Eml5 APN 12 98,771,751 (GRCm39) splice site probably benign
IGL01120:Eml5 APN 12 98,810,278 (GRCm39) missense probably benign
IGL01308:Eml5 APN 12 98,768,572 (GRCm39) missense probably damaging 1.00
IGL01790:Eml5 APN 12 98,765,191 (GRCm39) missense probably damaging 1.00
IGL01973:Eml5 APN 12 98,829,539 (GRCm39) missense probably benign
IGL02182:Eml5 APN 12 98,768,581 (GRCm39) missense probably damaging 1.00
IGL02201:Eml5 APN 12 98,760,683 (GRCm39) splice site probably benign
IGL02375:Eml5 APN 12 98,810,346 (GRCm39) missense probably damaging 1.00
IGL02397:Eml5 APN 12 98,756,933 (GRCm39) missense probably benign 0.07
IGL02480:Eml5 APN 12 98,842,502 (GRCm39) missense probably damaging 1.00
IGL02801:Eml5 APN 12 98,784,104 (GRCm39) missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98,825,100 (GRCm39) missense probably damaging 1.00
IGL03104:Eml5 APN 12 98,827,504 (GRCm39) nonsense probably null
IGL03158:Eml5 APN 12 98,793,773 (GRCm39) splice site probably benign
IGL03286:Eml5 APN 12 98,826,762 (GRCm39) missense probably damaging 1.00
IGL03380:Eml5 APN 12 98,840,906 (GRCm39) splice site probably benign
BB010:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98,791,031 (GRCm39) splice site probably null
R0624:Eml5 UTSW 12 98,831,738 (GRCm39) missense probably damaging 1.00
R0993:Eml5 UTSW 12 98,827,442 (GRCm39) missense probably benign 0.25
R1073:Eml5 UTSW 12 98,797,232 (GRCm39) missense probably damaging 1.00
R1183:Eml5 UTSW 12 98,758,305 (GRCm39) missense probably benign 0.31
R1352:Eml5 UTSW 12 98,797,262 (GRCm39) splice site probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1503:Eml5 UTSW 12 98,797,433 (GRCm39) missense probably damaging 0.99
R1538:Eml5 UTSW 12 98,760,535 (GRCm39) missense probably damaging 0.99
R1689:Eml5 UTSW 12 98,797,194 (GRCm39) missense probably damaging 1.00
R1773:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1775:Eml5 UTSW 12 98,818,963 (GRCm39) splice site probably null
R1791:Eml5 UTSW 12 98,853,315 (GRCm39) missense probably benign 0.31
R1856:Eml5 UTSW 12 98,776,843 (GRCm39) missense probably damaging 1.00
R1919:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1957:Eml5 UTSW 12 98,826,220 (GRCm39) missense probably damaging 1.00
R1962:Eml5 UTSW 12 98,842,570 (GRCm39) missense probably damaging 0.99
R2033:Eml5 UTSW 12 98,757,645 (GRCm39) missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98,760,525 (GRCm39) missense probably benign 0.33
R2073:Eml5 UTSW 12 98,768,705 (GRCm39) missense probably damaging 0.99
R2143:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2144:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2158:Eml5 UTSW 12 98,810,205 (GRCm39) splice site probably benign
R2164:Eml5 UTSW 12 98,853,356 (GRCm39) missense probably damaging 0.99
R2175:Eml5 UTSW 12 98,842,482 (GRCm39) nonsense probably null
R2200:Eml5 UTSW 12 98,791,676 (GRCm39) missense probably damaging 1.00
R2234:Eml5 UTSW 12 98,807,840 (GRCm39) missense probably damaging 1.00
R2504:Eml5 UTSW 12 98,810,364 (GRCm39) missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2958:Eml5 UTSW 12 98,842,437 (GRCm39) missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98,847,067 (GRCm39) splice site probably null
R3735:Eml5 UTSW 12 98,822,248 (GRCm39) missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98,782,283 (GRCm39) missense probably damaging 1.00
R3900:Eml5 UTSW 12 98,791,782 (GRCm39) missense probably damaging 1.00
R3973:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R3976:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R4105:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4107:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4108:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4109:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4258:Eml5 UTSW 12 98,831,693 (GRCm39) missense probably benign 0.01
R4381:Eml5 UTSW 12 98,782,214 (GRCm39) missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98,803,600 (GRCm39) missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98,765,111 (GRCm39) missense probably damaging 1.00
R4775:Eml5 UTSW 12 98,768,566 (GRCm39) missense probably benign 0.05
R4850:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5007:Eml5 UTSW 12 98,797,224 (GRCm39) missense probably damaging 1.00
R5092:Eml5 UTSW 12 98,758,875 (GRCm39) missense probably damaging 1.00
R5123:Eml5 UTSW 12 98,840,771 (GRCm39) missense probably damaging 1.00
R5124:Eml5 UTSW 12 98,758,301 (GRCm39) missense probably damaging 1.00
R5273:Eml5 UTSW 12 98,756,947 (GRCm39) missense probably damaging 1.00
R5369:Eml5 UTSW 12 98,825,042 (GRCm39) missense probably damaging 1.00
R5430:Eml5 UTSW 12 98,760,417 (GRCm39) missense probably damaging 1.00
R5748:Eml5 UTSW 12 98,791,814 (GRCm39) missense probably damaging 0.99
R5769:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5832:Eml5 UTSW 12 98,842,447 (GRCm39) missense probably benign
R6113:Eml5 UTSW 12 98,790,933 (GRCm39) nonsense probably null
R6131:Eml5 UTSW 12 98,827,510 (GRCm39) missense probably damaging 0.99
R6175:Eml5 UTSW 12 98,760,715 (GRCm39) missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98,829,388 (GRCm39) missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98,837,143 (GRCm39) missense probably damaging 0.98
R6375:Eml5 UTSW 12 98,765,127 (GRCm39)
R6528:Eml5 UTSW 12 98,790,896 (GRCm39) missense probably benign 0.18
R6657:Eml5 UTSW 12 98,757,664 (GRCm39) missense probably damaging 0.98
R6717:Eml5 UTSW 12 98,793,765 (GRCm39) missense probably damaging 1.00
R6751:Eml5 UTSW 12 98,831,659 (GRCm39) missense probably damaging 1.00
R6833:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6834:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6972:Eml5 UTSW 12 98,842,439 (GRCm39) missense probably benign 0.00
R7091:Eml5 UTSW 12 98,768,733 (GRCm39) missense probably benign 0.16
R7353:Eml5 UTSW 12 98,791,683 (GRCm39) missense
R7644:Eml5 UTSW 12 98,822,203 (GRCm39) missense probably benign 0.05
R7694:Eml5 UTSW 12 98,758,822 (GRCm39) missense probably damaging 0.99
R7842:Eml5 UTSW 12 98,760,394 (GRCm39) missense probably damaging 1.00
R7933:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98,758,773 (GRCm39) critical splice donor site probably null
R8198:Eml5 UTSW 12 98,825,145 (GRCm39) nonsense probably null
R8482:Eml5 UTSW 12 98,842,560 (GRCm39) missense probably damaging 1.00
R8732:Eml5 UTSW 12 98,782,218 (GRCm39) missense probably damaging 0.99
R8956:Eml5 UTSW 12 98,818,952 (GRCm39) missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98,776,829 (GRCm39) missense probably damaging 0.99
R9131:Eml5 UTSW 12 98,825,099 (GRCm39) missense probably damaging 1.00
R9258:Eml5 UTSW 12 98,810,376 (GRCm39) missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98,822,287 (GRCm39) missense probably damaging 0.99
R9276:Eml5 UTSW 12 98,765,060 (GRCm39) missense probably damaging 0.99
R9301:Eml5 UTSW 12 98,848,292 (GRCm39) nonsense probably null
R9368:Eml5 UTSW 12 98,762,837 (GRCm39) missense probably benign 0.31
R9392:Eml5 UTSW 12 98,867,199 (GRCm39) missense probably damaging 1.00
R9393:Eml5 UTSW 12 98,842,433 (GRCm39) missense probably benign 0.35
R9449:Eml5 UTSW 12 98,827,554 (GRCm39) missense probably damaging 1.00
R9570:Eml5 UTSW 12 98,782,243 (GRCm39) missense probably benign 0.15
T0722:Eml5 UTSW 12 98,807,841 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGTCGCTTTCCACTGC -3'
(R):5'- TCTGAGCTAGTTCAGGCACC -3'

Sequencing Primer
(F):5'- TATCTGAAGACCAGTCCAAGTG -3'
(R):5'- AGCTAGTTCAGGCACCATGGTC -3'
Posted On 2015-02-05