Incidental Mutation 'R3118:Ccdc125'
ID263135
Institutional Source Beutler Lab
Gene Symbol Ccdc125
Ensembl Gene ENSMUSG00000048924
Gene Namecoiled-coil domain containing 125
Synonyms5830436D01Rik
MMRRC Submission 040591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3118 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location100669717-100697240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100690319 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 228 (V228A)
Ref Sequence ENSEMBL: ENSMUSP00000058484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057325] [ENSMUST00000170347]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057325
AA Change: V228A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058484
Gene: ENSMUSG00000048924
AA Change: V228A

DomainStartEndE-ValueType
coiled coil region 101 193 N/A INTRINSIC
coiled coil region 286 308 N/A INTRINSIC
Blast:ETS 362 447 1e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170347
AA Change: V202A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130107
Gene: ENSMUSG00000048924
AA Change: V202A

DomainStartEndE-ValueType
coiled coil region 101 151 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T G 13: 104,314,279 D323E possibly damaging Het
Chrna2 A G 14: 66,150,993 I486V probably damaging Het
Cpxm1 T C 2: 130,393,573 T500A possibly damaging Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Cxcl1 T A 5: 90,891,595 probably null Het
Dab1 G A 4: 104,680,069 probably null Het
Ddx11 T A 17: 66,149,277 M751K probably damaging Het
Ece1 A G 4: 137,948,544 T410A probably benign Het
Eml5 C T 12: 98,865,494 V402I probably damaging Het
Fam241b A T 10: 62,108,856 *121R probably null Het
Fras1 G A 5: 96,771,712 A3595T probably damaging Het
Gpr149 A G 3: 62,595,022 V471A probably benign Het
Lemd3 A G 10: 120,947,251 S557P probably benign Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,419,214 probably benign Het
Mmp7 T C 9: 7,697,692 Y243H probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pak6 T C 2: 118,689,741 V71A probably damaging Het
Pira2 T A 7: 3,841,677 R452* probably null Het
Plxna1 A G 6: 89,356,976 S224P possibly damaging Het
Prpf39 T C 12: 65,057,877 V572A possibly damaging Het
Prss12 A T 3: 123,505,327 T583S possibly damaging Het
Rgs10 T C 7: 128,403,231 E65G probably damaging Het
Rnf19a T A 15: 36,241,899 K665* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Tbx15 T C 3: 99,352,154 I447T probably damaging Het
Tmem135 A G 7: 89,147,797 S364P probably benign Het
Ugt1a9 T C 1: 88,070,840 V4A probably benign Het
Zfp595 T C 13: 67,320,899 I95M probably benign Het
Other mutations in Ccdc125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Ccdc125 APN 13 100687102 splice site probably benign
IGL02867:Ccdc125 APN 13 100684282 splice site probably benign
R0002:Ccdc125 UTSW 13 100693606 nonsense probably null
R0014:Ccdc125 UTSW 13 100684338 missense possibly damaging 0.82
R0717:Ccdc125 UTSW 13 100690358 missense probably damaging 0.99
R1661:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R1665:Ccdc125 UTSW 13 100693573 missense probably benign 0.37
R3751:Ccdc125 UTSW 13 100677951 missense possibly damaging 0.90
R4415:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R4838:Ccdc125 UTSW 13 100677945 missense possibly damaging 0.52
R5734:Ccdc125 UTSW 13 100687114 missense possibly damaging 0.66
R5812:Ccdc125 UTSW 13 100684304 missense probably damaging 1.00
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6031:Ccdc125 UTSW 13 100684369 splice site probably null
R6419:Ccdc125 UTSW 13 100690326 missense probably damaging 1.00
R6456:Ccdc125 UTSW 13 100696309 missense possibly damaging 0.83
R6733:Ccdc125 UTSW 13 100694487 missense probably benign 0.04
R7183:Ccdc125 UTSW 13 100690358 missense possibly damaging 0.90
R7354:Ccdc125 UTSW 13 100677874 intron probably null
R7644:Ccdc125 UTSW 13 100678376 intron probably null
R7910:Ccdc125 UTSW 13 100682819 missense possibly damaging 0.83
R7948:Ccdc125 UTSW 13 100696402 missense probably benign 0.00
R7973:Ccdc125 UTSW 13 100669823 start gained probably benign
X0027:Ccdc125 UTSW 13 100681845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATGTCCTTTCTCCCATGATACC -3'
(R):5'- AACTGTGTCCCTCAGGCATG -3'

Sequencing Primer
(F):5'- CATGATACCTGCTGTTTCATCAG -3'
(R):5'- AAGCTAAGTTGCTGCCCTAG -3'
Posted On2015-02-05