Incidental Mutation 'R3118:Adamts6'
ID 263136
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms b2b2029Clo, b2b2182Clo, b2b2187.1Clo, b2b1879.1Clo, A930019D11Rik, ADAM-TS6, b2b2228Clo
MMRRC Submission 040591-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.847) question?
Stock # R3118 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 104424343-104633203 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 104450787 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 323 (D323E)
Ref Sequence ENSEMBL: ENSMUSP00000153359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000223562] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224504] [ENSMUST00000224742] [ENSMUST00000224784]
AlphaFold D3Z1A5
Predicted Effect possibly damaging
Transcript: ENSMUST00000065766
AA Change: D323E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: D323E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000223562
AA Change: D323E

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224208
AA Change: D323E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000224303
Predicted Effect probably benign
Transcript: ENSMUST00000224504
Predicted Effect probably benign
Transcript: ENSMUST00000224742
Predicted Effect possibly damaging
Transcript: ENSMUST00000224784
AA Change: D323E

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc125 T C 13: 100,826,827 (GRCm39) V228A possibly damaging Het
Chrna2 A G 14: 66,388,442 (GRCm39) I486V probably damaging Het
Cpxm1 T C 2: 130,235,493 (GRCm39) T500A possibly damaging Het
Crebbp G A 16: 3,927,062 (GRCm39) R628C probably damaging Het
Cxcl1 T A 5: 91,039,454 (GRCm39) probably null Het
Dab1 G A 4: 104,537,266 (GRCm39) probably null Het
Ddx11 T A 17: 66,456,272 (GRCm39) M751K probably damaging Het
Ece1 A G 4: 137,675,855 (GRCm39) T410A probably benign Het
Eml5 C T 12: 98,831,753 (GRCm39) V402I probably damaging Het
Fam241b A T 10: 61,944,635 (GRCm39) *121R probably null Het
Fras1 G A 5: 96,919,571 (GRCm39) A3595T probably damaging Het
Gpr149 A G 3: 62,502,443 (GRCm39) V471A probably benign Het
Lemd3 A G 10: 120,783,156 (GRCm39) S557P probably benign Het
Mkrn3 CGGCATTGGCACTGGCATTGGCACTGGCATTGGCA CGGCATTGGCACTGGCATTGGCA 7: 62,068,962 (GRCm39) probably benign Het
Mmp7 T C 9: 7,697,693 (GRCm39) Y243H probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Pak6 T C 2: 118,520,222 (GRCm39) V71A probably damaging Het
Pira2 T A 7: 3,844,676 (GRCm39) R452* probably null Het
Plxna1 A G 6: 89,333,958 (GRCm39) S224P possibly damaging Het
Prpf39 T C 12: 65,104,651 (GRCm39) V572A possibly damaging Het
Prss12 A T 3: 123,298,976 (GRCm39) T583S possibly damaging Het
Rgs10 T C 7: 128,004,955 (GRCm39) E65G probably damaging Het
Rnf19a T A 15: 36,242,045 (GRCm39) K665* probably null Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Tbx15 T C 3: 99,259,470 (GRCm39) I447T probably damaging Het
Tmem135 A G 7: 88,797,005 (GRCm39) S364P probably benign Het
Ugt1a9 T C 1: 87,998,562 (GRCm39) V4A probably benign Het
Zfp595 T C 13: 67,468,963 (GRCm39) I95M probably benign Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104,566,298 (GRCm39) missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104,433,726 (GRCm39) nonsense probably null
IGL01305:Adamts6 APN 13 104,526,590 (GRCm39) missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104,433,672 (GRCm39) missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104,526,700 (GRCm39) splice site probably benign
IGL01678:Adamts6 APN 13 104,450,196 (GRCm39) missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104,526,643 (GRCm39) missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104,450,168 (GRCm39) missense probably null 1.00
IGL02217:Adamts6 APN 13 104,598,873 (GRCm39) splice site probably benign
IGL02828:Adamts6 APN 13 104,433,978 (GRCm39) missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104,433,783 (GRCm39) missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104,581,464 (GRCm39) utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104,580,723 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104,450,842 (GRCm39) missense possibly damaging 0.77
De_vito UTSW 13 104,483,900 (GRCm39) critical splice donor site probably null
festinator UTSW 13 104,616,043 (GRCm39) missense probably damaging 1.00
ANU22:Adamts6 UTSW 13 104,526,590 (GRCm39) missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104,433,999 (GRCm39) missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104,526,584 (GRCm39) critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104,563,438 (GRCm39) splice site probably benign
R0549:Adamts6 UTSW 13 104,433,763 (GRCm39) missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104,581,435 (GRCm39) missense probably benign 0.00
R0703:Adamts6 UTSW 13 104,489,355 (GRCm39) missense probably damaging 1.00
R0799:Adamts6 UTSW 13 104,450,779 (GRCm39) missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104,550,297 (GRCm39) missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104,449,389 (GRCm39) missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104,630,145 (GRCm39) missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104,581,383 (GRCm39) missense probably benign 0.26
R1619:Adamts6 UTSW 13 104,449,285 (GRCm39) missense probably benign 0.14
R1727:Adamts6 UTSW 13 104,565,472 (GRCm39) splice site probably benign
R1967:Adamts6 UTSW 13 104,563,459 (GRCm39) nonsense probably null
R2013:Adamts6 UTSW 13 104,450,812 (GRCm39) missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104,598,746 (GRCm39) missense probably benign 0.00
R2432:Adamts6 UTSW 13 104,563,485 (GRCm39) missense probably benign 0.01
R4125:Adamts6 UTSW 13 104,449,412 (GRCm39) missense probably damaging 1.00
R4274:Adamts6 UTSW 13 104,450,787 (GRCm39) missense possibly damaging 0.91
R4795:Adamts6 UTSW 13 104,580,636 (GRCm39) nonsense probably null
R4841:Adamts6 UTSW 13 104,449,295 (GRCm39) missense probably benign 0.00
R4976:Adamts6 UTSW 13 104,433,998 (GRCm39) missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104,443,751 (GRCm39) missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104,630,130 (GRCm39) missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104,489,323 (GRCm39) missense possibly damaging 0.86
R5753:Adamts6 UTSW 13 104,483,858 (GRCm39) missense probably damaging 1.00
R6027:Adamts6 UTSW 13 104,616,043 (GRCm39) missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104,433,933 (GRCm39) missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104,483,900 (GRCm39) critical splice donor site probably null
R6243:Adamts6 UTSW 13 104,450,809 (GRCm39) missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104,598,790 (GRCm39) missense probably benign
R6743:Adamts6 UTSW 13 104,565,436 (GRCm39) missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104,450,160 (GRCm39) missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104,449,267 (GRCm39) missense probably benign
R7351:Adamts6 UTSW 13 104,526,620 (GRCm39) missense possibly damaging 0.63
R7520:Adamts6 UTSW 13 104,433,694 (GRCm39) missense probably benign 0.01
R7866:Adamts6 UTSW 13 104,550,257 (GRCm39) nonsense probably null
R8274:Adamts6 UTSW 13 104,450,181 (GRCm39) missense probably benign 0.02
R8348:Adamts6 UTSW 13 104,616,027 (GRCm39) missense probably damaging 0.99
R8448:Adamts6 UTSW 13 104,616,027 (GRCm39) missense probably damaging 0.99
R8686:Adamts6 UTSW 13 104,450,207 (GRCm39) missense probably damaging 1.00
R8691:Adamts6 UTSW 13 104,450,839 (GRCm39) missense probably benign 0.00
R8962:Adamts6 UTSW 13 104,433,899 (GRCm39) missense probably damaging 0.99
R8978:Adamts6 UTSW 13 104,512,247 (GRCm39) missense probably damaging 1.00
R9075:Adamts6 UTSW 13 104,598,793 (GRCm39) missense probably benign
R9080:Adamts6 UTSW 13 104,449,427 (GRCm39) missense probably damaging 1.00
R9152:Adamts6 UTSW 13 104,613,275 (GRCm39) missense probably benign 0.06
R9213:Adamts6 UTSW 13 104,581,440 (GRCm39) missense probably damaging 1.00
R9536:Adamts6 UTSW 13 104,489,313 (GRCm39) missense probably benign 0.07
R9674:Adamts6 UTSW 13 104,563,448 (GRCm39) missense probably benign 0.17
X0065:Adamts6 UTSW 13 104,630,136 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTAGGTCAGATGTTCTGGAG -3'
(R):5'- TCCTATCCCTTATTACCTGAAAGAG -3'

Sequencing Primer
(F):5'- ATGTTCTGGAGATAAAAATCGGC -3'
(R):5'- CCTGAAAGAGGTGTAGAGAAAACC -3'
Posted On 2015-02-05