Mutagenetix > Incidental Mutation

Incidental Mutation 'R3119:Atp1a4'

263141

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

040592-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3119 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 172239826 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 580 (F580L)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

probably damaging
Transcript: ENSMUST00000111243
AA Change: F580L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: F580L

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191616

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AW551984	T	C	9: 39,593,360	T532A	probably benign	Het
Cstf1	A	G	2: 172,373,070	E37G	possibly damaging	Het
Cubn	A	C	2: 13,358,162	F1679L	possibly damaging	Het
Dqx1	C	A	6: 83,066,235	S651*	probably null	Het
Fhad1	CG	C	4: 141,918,307		probably null	Het
Gata3	T	C	2: 9,877,585		probably null	Het
Gm906	A	T	13: 50,246,969	Y440*	probably null	Het
L3mbtl4	G	A	17: 68,425,674	E50K	probably benign	Het
Man1a	T	A	10: 54,030,794	M295L	probably damaging	Het
Mbip	A	G	12: 56,345,703	V33A	probably benign	Het
Mrpl9	A	T	3: 94,447,790	N223I	probably damaging	Het
Nrxn1	G	A	17: 90,597,519	Q219*	probably null	Het
Olfr919	T	A	9: 38,697,659	K236*	probably null	Het
Prss12	A	T	3: 123,505,327	T583S	possibly damaging	Het
Rgs10	T	C	7: 128,403,231	E65G	probably damaging	Het
Syne2	T	A	12: 75,909,284	M588K	probably benign	Het
Tmem135	A	G	7: 89,147,797	S364P	probably benign	Het
Ttc41	T	C	10: 86,724,320	M369T	possibly damaging	Het
Vwa3b	G	A	1: 37,109,077	V437I	possibly damaging	Het
Zfp418	A	G	7: 7,181,689	H217R	possibly damaging	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- ACTTGTTCCTTCAAGCTGTGAG -3'
(R):5'- TGCCTACATAGAACTGGGAGG -3'

Sequencing Primer
(F):5'- CCTTCAAGCTGTGAGGAGTG -3'
(R):5'- CCTACATAGAACTGGGAGGTCTGG -3'

Posted On

2015-02-05