Incidental Mutation 'R3119:Prss12'
ID263145
Institutional Source Beutler Lab
Gene Symbol Prss12
Ensembl Gene ENSMUSG00000027978
Gene Nameprotease, serine 12 neurotrypsin (motopsin)
Synonymsmotopsin, Bssp-3
MMRRC Submission 040592-MU
Accession Numbers

Genbank: NM_008939.2

Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3119 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123446913-123506597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123505327 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 583 (T583S)
Ref Sequence ENSEMBL: ENSMUSP00000029603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029603
AA Change: T583S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029603
Gene: ENSMUSG00000027978
AA Change: T583S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 43 N/A INTRINSIC
low complexity region 45 64 N/A INTRINSIC
KR 83 159 2.07e-21 SMART
SR 166 266 4.68e-57 SMART
SR 273 372 9.67e-50 SMART
SR 386 486 3.55e-57 SMART
Tryp_SPc 516 755 6.38e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199645
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. Studies in mouse suggest that the encoded enzyme may be involved in structural reorganizations associated with learning and memory. The enzyme is also expressed in Leydig cells in the testis, but its function in this tissue is unknown. Defects in this gene are a cause of mental retardation autosomal recessive type 1 (MRT1). [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display hypoactivity and increased anxiety. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1a4 A G 1: 172,239,826 F580L probably damaging Het
AW551984 T C 9: 39,593,360 T532A probably benign Het
Cstf1 A G 2: 172,373,070 E37G possibly damaging Het
Cubn A C 2: 13,358,162 F1679L possibly damaging Het
Dqx1 C A 6: 83,066,235 S651* probably null Het
Fhad1 CG C 4: 141,918,307 probably null Het
Gata3 T C 2: 9,877,585 probably null Het
Gm906 A T 13: 50,246,969 Y440* probably null Het
L3mbtl4 G A 17: 68,425,674 E50K probably benign Het
Man1a T A 10: 54,030,794 M295L probably damaging Het
Mbip A G 12: 56,345,703 V33A probably benign Het
Mrpl9 A T 3: 94,447,790 N223I probably damaging Het
Nrxn1 G A 17: 90,597,519 Q219* probably null Het
Olfr919 T A 9: 38,697,659 K236* probably null Het
Rgs10 T C 7: 128,403,231 E65G probably damaging Het
Syne2 T A 12: 75,909,284 M588K probably benign Het
Tmem135 A G 7: 89,147,797 S364P probably benign Het
Ttc41 T C 10: 86,724,320 M369T possibly damaging Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Zfp418 A G 7: 7,181,689 H217R possibly damaging Het
Other mutations in Prss12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prss12 APN 3 123486949 splice site probably benign
IGL01090:Prss12 APN 3 123482739 missense possibly damaging 0.85
IGL01609:Prss12 APN 3 123482834 missense probably damaging 1.00
IGL02406:Prss12 APN 3 123505474 missense possibly damaging 0.81
IGL02445:Prss12 APN 3 123487020 missense probably damaging 1.00
IGL02928:Prss12 APN 3 123487156 missense possibly damaging 0.51
IGL02970:Prss12 APN 3 123482762 missense probably benign 0.03
IGL03116:Prss12 APN 3 123506276 missense probably benign
IGL03149:Prss12 APN 3 123505387 missense probably benign 0.00
nerd UTSW 3 123447384 missense probably benign 0.31
twerp UTSW 3 123482774 missense probably damaging 1.00
F5426:Prss12 UTSW 3 123506472 missense probably damaging 1.00
P4717OSA:Prss12 UTSW 3 123447618 missense probably damaging 1.00
PIT4576001:Prss12 UTSW 3 123487115 missense probably damaging 1.00
R0116:Prss12 UTSW 3 123482774 missense probably damaging 1.00
R0528:Prss12 UTSW 3 123482796 missense probably benign 0.00
R0762:Prss12 UTSW 3 123485504 missense probably damaging 1.00
R1051:Prss12 UTSW 3 123485525 missense probably null 0.99
R1916:Prss12 UTSW 3 123506495 missense probably benign 0.07
R2185:Prss12 UTSW 3 123487144 missense probably benign 0.01
R2389:Prss12 UTSW 3 123487021 missense possibly damaging 0.63
R2938:Prss12 UTSW 3 123486976 missense probably benign 0.00
R3118:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R4080:Prss12 UTSW 3 123485485 missense probably benign 0.44
R4161:Prss12 UTSW 3 123485527 nonsense probably null
R4997:Prss12 UTSW 3 123447208 missense probably benign 0.01
R5291:Prss12 UTSW 3 123505463 missense probably damaging 0.98
R5597:Prss12 UTSW 3 123464740 missense probably benign 0.18
R5941:Prss12 UTSW 3 123505501 missense probably benign 0.01
R6005:Prss12 UTSW 3 123482768 missense probably benign 0.00
R6119:Prss12 UTSW 3 123489609 missense possibly damaging 0.64
R6430:Prss12 UTSW 3 123479594 missense probably damaging 1.00
R6492:Prss12 UTSW 3 123447399 missense probably benign
R6864:Prss12 UTSW 3 123447384 missense probably benign 0.31
R7334:Prss12 UTSW 3 123487131 missense probably benign
R7492:Prss12 UTSW 3 123482776 nonsense probably null
R7669:Prss12 UTSW 3 123447396 missense probably benign
R7898:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
R8206:Prss12 UTSW 3 123464962 splice site probably null
R8835:Prss12 UTSW 3 123491552 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GAACAATGGGCTTCCAGGAG -3'
(R):5'- TCCATAGAGGTAAACAGGCTGG -3'

Sequencing Primer
(F):5'- AATGGTAAGATGGCTAAGTTTGC -3'
(R):5'- GCAAAACGTGGGTGCTTAGTC -3'
Posted On2015-02-05