Incidental Mutation 'R3119:Ttc41'
ID 263153
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
MMRRC Submission 040592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R3119 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86724320 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 369 (M369T)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061458
AA Change: M369T

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937
AA Change: M369T

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075632
AA Change: M369T

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: M369T

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217747
AA Change: M369T

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: M369T

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1a4 A G 1: 172,239,826 F580L probably damaging Het
AW551984 T C 9: 39,593,360 T532A probably benign Het
Cstf1 A G 2: 172,373,070 E37G possibly damaging Het
Cubn A C 2: 13,358,162 F1679L possibly damaging Het
Dqx1 C A 6: 83,066,235 S651* probably null Het
Fhad1 CG C 4: 141,918,307 probably null Het
Gata3 T C 2: 9,877,585 probably null Het
Gm906 A T 13: 50,246,969 Y440* probably null Het
L3mbtl4 G A 17: 68,425,674 E50K probably benign Het
Man1a T A 10: 54,030,794 M295L probably damaging Het
Mbip A G 12: 56,345,703 V33A probably benign Het
Mrpl9 A T 3: 94,447,790 N223I probably damaging Het
Nrxn1 G A 17: 90,597,519 Q219* probably null Het
Olfr919 T A 9: 38,697,659 K236* probably null Het
Prss12 A T 3: 123,505,327 T583S possibly damaging Het
Rgs10 T C 7: 128,403,231 E65G probably damaging Het
Syne2 T A 12: 75,909,284 M588K probably benign Het
Tmem135 A G 7: 89,147,797 S364P probably benign Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Zfp418 A G 7: 7,181,689 H217R possibly damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCCAAGGAGGGATGACTC -3'
(R):5'- ACTTTGACAAGCGAGATGGG -3'

Sequencing Primer
(F):5'- GCCAGAGCATCACATATTTTAGAGG -3'
(R):5'- ATGGGAGGTGTTTAAAGCAGTC -3'
Posted On 2015-02-05