Mutagenetix > Incidental Mutations

Incidental Mutation 'R3119:Gm906'

263156

Institutional Source

Beutler Lab

Gene Symbol

Gm906

Ensembl Gene

ENSMUSG00000095300

Gene Name

predicted gene 906

Synonyms

LOC380882

MMRRC Submission

040592-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R3119 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50245181-50250308 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 50246969 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 440 (Y440*)

Ref Sequence

ENSEMBL: ENSMUSP00000097121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099521]

Predicted Effect

probably null
Transcript: ENSMUST00000099521
AA Change: Y440*

SMART Domains

Protein: ENSMUSP00000097121
Gene: ENSMUSG00000095300
AA Change: Y440*

Domain	Start	End	E-Value	Type
low complexity region	69	82	N/A	INTRINSIC
Pfam:FAM75	96	414	5.3e-15	PFAM
SCOP:d1i5pa1	811	874	1e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp1a4	A	G	1: 172,239,826	F580L	probably damaging	Het
AW551984	T	C	9: 39,593,360	T532A	probably benign	Het
Cstf1	A	G	2: 172,373,070	E37G	possibly damaging	Het
Cubn	A	C	2: 13,358,162	F1679L	possibly damaging	Het
Dqx1	C	A	6: 83,066,235	S651*	probably null	Het
Fhad1	CG	C	4: 141,918,307		probably null	Het
Gata3	T	C	2: 9,877,585		probably null	Het
L3mbtl4	G	A	17: 68,425,674	E50K	probably benign	Het
Man1a	T	A	10: 54,030,794	M295L	probably damaging	Het
Mbip	A	G	12: 56,345,703	V33A	probably benign	Het
Mrpl9	A	T	3: 94,447,790	N223I	probably damaging	Het
Nrxn1	G	A	17: 90,597,519	Q219*	probably null	Het
Olfr919	T	A	9: 38,697,659	K236*	probably null	Het
Prss12	A	T	3: 123,505,327	T583S	possibly damaging	Het
Rgs10	T	C	7: 128,403,231	E65G	probably damaging	Het
Syne2	T	A	12: 75,909,284	M588K	probably benign	Het
Tmem135	A	G	7: 89,147,797	S364P	probably benign	Het
Ttc41	T	C	10: 86,724,320	M369T	possibly damaging	Het
Vwa3b	G	A	1: 37,109,077	V437I	possibly damaging	Het
Zfp418	A	G	7: 7,181,689	H217R	possibly damaging	Het

Other mutations in Gm906

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00575:Gm906	APN	13	50246716	missense	probably damaging	1.00
IGL02008:Gm906	APN	13	50246685	missense	probably benign	0.00
R0464:Gm906	UTSW	13	50248275	splice site	probably benign
R0481:Gm906	UTSW	13	50246964	missense	probably benign	0.33
R0781:Gm906	UTSW	13	50248260	missense	possibly damaging	0.70
R1110:Gm906	UTSW	13	50248260	missense	possibly damaging	0.70
R1945:Gm906	UTSW	13	50245491	missense	probably damaging	1.00
R3824:Gm906	UTSW	13	50245512	missense	possibly damaging	0.73
R3861:Gm906	UTSW	13	50246851	missense	probably benign	0.00
R4256:Gm906	UTSW	13	50250105	missense	probably benign	0.18
R4607:Gm906	UTSW	13	50245506	missense	possibly damaging	0.86
R6126:Gm906	UTSW	13	50246290	missense	probably benign	0.18
R6550:Gm906	UTSW	13	50245446	missense	probably benign	0.00
R6913:Gm906	UTSW	13	50245257	missense	probably damaging	0.99
R6970:Gm906	UTSW	13	50246971	missense	possibly damaging	0.86
R7339:Gm906	UTSW	13	50247168	missense	possibly damaging	0.86
R7347:Gm906	UTSW	13	50245744	missense	probably benign	0.01
R7607:Gm906	UTSW	13	50250260	missense	possibly damaging	0.72
R7655:Gm906	UTSW	13	50247086	missense	probably benign	0.00
R7656:Gm906	UTSW	13	50247086	missense	probably benign	0.00
R7711:Gm906	UTSW	13	50247095	missense	probably benign	0.43
R7803:Gm906	UTSW	13	50246190	missense	probably benign	0.33
R8382:Gm906	UTSW	13	50247438	missense	possibly damaging	0.71
R8510:Gm906	UTSW	13	50250192	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCCTCTGGAAGTGAGTGTATAAAC -3'
(R):5'- TCAAGAAGGACCTTGGTGTG -3'

Sequencing Primer
(F):5'- GAGTGTATAAACTCAGCTCTCTCTGG -3'
(R):5'- CTTGGTGTGGGGGCACAAAAG -3'

Posted On

2015-02-05