Incidental Mutation 'R3119:Gm906'
ID263156
Institutional Source Beutler Lab
Gene Symbol Gm906
Ensembl Gene ENSMUSG00000095300
Gene Namepredicted gene 906
SynonymsLOC380882
MMRRC Submission 040592-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3119 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location50245181-50250308 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 50246969 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 440 (Y440*)
Ref Sequence ENSEMBL: ENSMUSP00000097121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099521]
Predicted Effect probably null
Transcript: ENSMUST00000099521
AA Change: Y440*
SMART Domains Protein: ENSMUSP00000097121
Gene: ENSMUSG00000095300
AA Change: Y440*

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
Pfam:FAM75 96 414 5.3e-15 PFAM
SCOP:d1i5pa1 811 874 1e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1a4 A G 1: 172,239,826 F580L probably damaging Het
AW551984 T C 9: 39,593,360 T532A probably benign Het
Cstf1 A G 2: 172,373,070 E37G possibly damaging Het
Cubn A C 2: 13,358,162 F1679L possibly damaging Het
Dqx1 C A 6: 83,066,235 S651* probably null Het
Fhad1 CG C 4: 141,918,307 probably null Het
Gata3 T C 2: 9,877,585 probably null Het
L3mbtl4 G A 17: 68,425,674 E50K probably benign Het
Man1a T A 10: 54,030,794 M295L probably damaging Het
Mbip A G 12: 56,345,703 V33A probably benign Het
Mrpl9 A T 3: 94,447,790 N223I probably damaging Het
Nrxn1 G A 17: 90,597,519 Q219* probably null Het
Olfr919 T A 9: 38,697,659 K236* probably null Het
Prss12 A T 3: 123,505,327 T583S possibly damaging Het
Rgs10 T C 7: 128,403,231 E65G probably damaging Het
Syne2 T A 12: 75,909,284 M588K probably benign Het
Tmem135 A G 7: 89,147,797 S364P probably benign Het
Ttc41 T C 10: 86,724,320 M369T possibly damaging Het
Vwa3b G A 1: 37,109,077 V437I possibly damaging Het
Zfp418 A G 7: 7,181,689 H217R possibly damaging Het
Other mutations in Gm906
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00575:Gm906 APN 13 50246716 missense probably damaging 1.00
IGL02008:Gm906 APN 13 50246685 missense probably benign 0.00
R0464:Gm906 UTSW 13 50248275 splice site probably benign
R0481:Gm906 UTSW 13 50246964 missense probably benign 0.33
R0781:Gm906 UTSW 13 50248260 missense possibly damaging 0.70
R1110:Gm906 UTSW 13 50248260 missense possibly damaging 0.70
R1945:Gm906 UTSW 13 50245491 missense probably damaging 1.00
R3824:Gm906 UTSW 13 50245512 missense possibly damaging 0.73
R3861:Gm906 UTSW 13 50246851 missense probably benign 0.00
R4256:Gm906 UTSW 13 50250105 missense probably benign 0.18
R4607:Gm906 UTSW 13 50245506 missense possibly damaging 0.86
R6126:Gm906 UTSW 13 50246290 missense probably benign 0.18
R6550:Gm906 UTSW 13 50245446 missense probably benign 0.00
R6913:Gm906 UTSW 13 50245257 missense probably damaging 0.99
R6970:Gm906 UTSW 13 50246971 missense possibly damaging 0.86
R7339:Gm906 UTSW 13 50247168 missense possibly damaging 0.86
R7347:Gm906 UTSW 13 50245744 missense probably benign 0.01
R7607:Gm906 UTSW 13 50250260 missense possibly damaging 0.72
R7655:Gm906 UTSW 13 50247086 missense probably benign 0.00
R7656:Gm906 UTSW 13 50247086 missense probably benign 0.00
R7711:Gm906 UTSW 13 50247095 missense probably benign 0.43
R7803:Gm906 UTSW 13 50246190 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCCTCTGGAAGTGAGTGTATAAAC -3'
(R):5'- TCAAGAAGGACCTTGGTGTG -3'

Sequencing Primer
(F):5'- GAGTGTATAAACTCAGCTCTCTCTGG -3'
(R):5'- CTTGGTGTGGGGGCACAAAAG -3'
Posted On2015-02-05