Incidental Mutation 'R3120:Ptdss2'
ID263174
Institutional Source Beutler Lab
Gene Symbol Ptdss2
Ensembl Gene ENSMUSG00000025495
Gene Namephosphatidylserine synthase 2
SynonymsPSS2
MMRRC Submission 040593-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3120 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141122382-141157606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141152219 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 140 (H140Y)
Ref Sequence ENSEMBL: ENSMUSP00000133352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026568] [ENSMUST00000172479] [ENSMUST00000172787] [ENSMUST00000209928]
Predicted Effect probably damaging
Transcript: ENSMUST00000026568
AA Change: H178Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026568
Gene: ENSMUSG00000025495
AA Change: H178Y

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
Pfam:PSS 98 378 1.8e-113 PFAM
transmembrane domain 388 410 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172479
Predicted Effect probably damaging
Transcript: ENSMUST00000172787
AA Change: H140Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133352
Gene: ENSMUSG00000025495
AA Change: H140Y

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
Pfam:PSS 60 191 7.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174706
Predicted Effect probably benign
Transcript: ENSMUST00000209928
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the conversion of phosphatidylethanolamine to phosphatidylserine, a structural membrane phospholipid that functions in cell signaling, blood coagulation, and apoptosis. The encoded enzyme also has a high affinity for docosahexaenoic acid (DHA) and can use it to make DHA-containing phosphatidylserine. [provided by RefSeq, Jul 2016]
PHENOTYPE: Disruption of this gene causes infertility in about 10% of homozygous males. The remaining males and all females were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bsx A G 9: 40,877,612 K155R possibly damaging Het
Ccdc39 T C 3: 33,837,838 K162E probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnah1 G A 14: 31,266,822 R3351* probably null Het
Eml1 A G 12: 108,513,053 R362G probably benign Het
Fam222b T C 11: 78,153,916 L101P probably damaging Het
Fars2 A G 13: 36,246,417 E276G probably damaging Het
Gatad1 G T 5: 3,641,456 Y33* probably null Het
Gclc A C 9: 77,781,270 E219A possibly damaging Het
Gm4846 A G 1: 166,491,548 V207A probably benign Het
Hbq1a T C 11: 32,300,472 L87P probably damaging Het
Hist1h1b A T 13: 21,780,045 S170R probably benign Het
Magea6 A T X: 154,924,295 I255N probably benign Het
Mfsd12 T G 10: 81,361,215 V206G probably benign Het
Mis18bp1 T C 12: 65,156,988 probably null Het
Nf1 C A 11: 79,564,899 T550K probably damaging Het
Nlrp4f T C 13: 65,194,716 T372A probably benign Het
Olfr495 T C 7: 108,395,723 I201T possibly damaging Het
Pkdcc T C 17: 83,220,037 Y215H probably damaging Het
Plekha5 A G 6: 140,591,641 T253A probably benign Het
Polr2f T A 15: 79,144,588 probably null Het
Prph2 C T 17: 46,923,372 A289V possibly damaging Het
Rlf T A 4: 121,149,483 I877L probably benign Het
Scgb2b2 T C 7: 31,303,576 L32S possibly damaging Het
Sfpq T A 4: 127,022,133 H239Q unknown Het
St6gal2 A T 17: 55,482,110 R48S probably benign Het
Sybu T C 15: 44,672,959 D657G possibly damaging Het
Syt15 A G 14: 34,222,993 I166V probably benign Het
Taar7f C A 10: 24,049,580 T24K probably benign Het
Tbcd T C 11: 121,608,648 S1093P probably damaging Het
Tfap2c G A 2: 172,557,095 V396M possibly damaging Het
Tnxb C T 17: 34,692,355 T1544I possibly damaging Het
Trim28 A G 7: 13,028,414 T322A probably damaging Het
Tubgcp3 G A 8: 12,657,626 A121V possibly damaging Het
Vmn2r14 A T 5: 109,224,565 W20R probably null Het
Zfp551 A G 7: 12,416,016 F489L possibly damaging Het
Other mutations in Ptdss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Ptdss2 APN 7 141143125 missense probably benign 0.35
IGL01860:Ptdss2 APN 7 141152836 missense probably damaging 1.00
IGL01966:Ptdss2 APN 7 141135391 missense possibly damaging 0.66
IGL02606:Ptdss2 APN 7 141152998 nonsense probably null
R0105:Ptdss2 UTSW 7 141152880 missense probably damaging 1.00
R0138:Ptdss2 UTSW 7 141155319 splice site probably benign
R0503:Ptdss2 UTSW 7 141151797 unclassified probably benign
R2397:Ptdss2 UTSW 7 141147092 missense probably benign 0.02
R4519:Ptdss2 UTSW 7 141154578 missense probably benign 0.30
R4728:Ptdss2 UTSW 7 141154459 missense probably benign 0.30
R5158:Ptdss2 UTSW 7 141151771 missense probably benign 0.16
R6186:Ptdss2 UTSW 7 141154949 unclassified probably benign
R6464:Ptdss2 UTSW 7 141152211 missense probably damaging 1.00
R6580:Ptdss2 UTSW 7 141153012 missense probably damaging 1.00
R7290:Ptdss2 UTSW 7 141151780 missense possibly damaging 0.58
R7307:Ptdss2 UTSW 7 141151732 missense possibly damaging 0.51
R7444:Ptdss2 UTSW 7 141153084 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGTCATCTGAAGCAGCACAC -3'
(R):5'- CCTGAGAAACTGCAAGTCTCTGG -3'

Sequencing Primer
(F):5'- CATCAGCCTGGAGGGTTG -3'
(R):5'- GAAACTGCAAGTCTCTGGTATCTTAC -3'
Posted On2015-02-05