Incidental Mutation 'R3120:Gclc'
ID263177
Institutional Source Beutler Lab
Gene Symbol Gclc
Ensembl Gene ENSMUSG00000032350
Gene Nameglutamate-cysteine ligase, catalytic subunit
SynonymsD9Wsu168e, gamma GCS-HS, GLCL-H, Glclc
MMRRC Submission 040593-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3120 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location77754535-77794485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 77781270 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 219 (E219A)
Ref Sequence ENSEMBL: ENSMUSP00000034905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034905
AA Change: E219A

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034905
Gene: ENSMUSG00000032350
AA Change: E219A

DomainStartEndE-ValueType
Pfam:GCS 236 608 1.3e-185 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216848
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase is the first rate-limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. This locus encodes the catalytic subunit, while the regulatory subunit is derived from a different gene located on chromosome 1p22-p21. Mutations at this locus have been associated with hemolytic anemia due to deficiency of gamma-glutamylcysteine synthetase and susceptibility to myocardial infarction.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice are embryonic lethal. One model shows lethality before E13 while another shows lethality between E7.5-E8.5. In this second model, embryos are arrested at the egg cylinder stage, fail to gastrulate, do not form mesoderm, and exhibitincreased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bsx A G 9: 40,877,612 K155R possibly damaging Het
Ccdc39 T C 3: 33,837,838 K162E probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnah1 G A 14: 31,266,822 R3351* probably null Het
Eml1 A G 12: 108,513,053 R362G probably benign Het
Fam222b T C 11: 78,153,916 L101P probably damaging Het
Fars2 A G 13: 36,246,417 E276G probably damaging Het
Gatad1 G T 5: 3,641,456 Y33* probably null Het
Gm4846 A G 1: 166,491,548 V207A probably benign Het
Hbq1a T C 11: 32,300,472 L87P probably damaging Het
Hist1h1b A T 13: 21,780,045 S170R probably benign Het
Magea6 A T X: 154,924,295 I255N probably benign Het
Mfsd12 T G 10: 81,361,215 V206G probably benign Het
Mis18bp1 T C 12: 65,156,988 probably null Het
Nf1 C A 11: 79,564,899 T550K probably damaging Het
Nlrp4f T C 13: 65,194,716 T372A probably benign Het
Olfr495 T C 7: 108,395,723 I201T possibly damaging Het
Pkdcc T C 17: 83,220,037 Y215H probably damaging Het
Plekha5 A G 6: 140,591,641 T253A probably benign Het
Polr2f T A 15: 79,144,588 probably null Het
Prph2 C T 17: 46,923,372 A289V possibly damaging Het
Ptdss2 C T 7: 141,152,219 H140Y probably damaging Het
Rlf T A 4: 121,149,483 I877L probably benign Het
Scgb2b2 T C 7: 31,303,576 L32S possibly damaging Het
Sfpq T A 4: 127,022,133 H239Q unknown Het
St6gal2 A T 17: 55,482,110 R48S probably benign Het
Sybu T C 15: 44,672,959 D657G possibly damaging Het
Syt15 A G 14: 34,222,993 I166V probably benign Het
Taar7f C A 10: 24,049,580 T24K probably benign Het
Tbcd T C 11: 121,608,648 S1093P probably damaging Het
Tfap2c G A 2: 172,557,095 V396M possibly damaging Het
Tnxb C T 17: 34,692,355 T1544I possibly damaging Het
Trim28 A G 7: 13,028,414 T322A probably damaging Het
Tubgcp3 G A 8: 12,657,626 A121V possibly damaging Het
Vmn2r14 A T 5: 109,224,565 W20R probably null Het
Zfp551 A G 7: 12,416,016 F489L possibly damaging Het
Other mutations in Gclc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Gclc APN 9 77792060 missense probably benign
IGL02059:Gclc APN 9 77787816 missense probably damaging 1.00
R0671:Gclc UTSW 9 77786798 missense probably damaging 1.00
R1469:Gclc UTSW 9 77781137 missense probably benign 0.01
R1469:Gclc UTSW 9 77781137 missense probably benign 0.01
R1700:Gclc UTSW 9 77776289 missense probably benign 0.04
R3830:Gclc UTSW 9 77791960 missense probably benign 0.24
R6747:Gclc UTSW 9 77788245 missense probably damaging 0.96
R7028:Gclc UTSW 9 77788216 missense probably damaging 1.00
R7120:Gclc UTSW 9 77786750 missense probably damaging 1.00
R7242:Gclc UTSW 9 77785371 missense probably benign 0.00
R7329:Gclc UTSW 9 77776191 missense probably damaging 1.00
R7716:Gclc UTSW 9 77754927 missense probably damaging 1.00
X0021:Gclc UTSW 9 77788209 missense probably damaging 1.00
Z1088:Gclc UTSW 9 77781367 splice site probably null
Z1177:Gclc UTSW 9 77786739 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCTCAGATTCTAATGTGGCAG -3'
(R):5'- CTTTCGAATCAGATTAGAAGGTGAC -3'

Sequencing Primer
(F):5'- TGCTTGCTGTAGTACTCTAACAAG -3'
(R):5'- GGTGACTTTAAACCAGACACATG -3'
Posted On2015-02-05