Incidental Mutation 'R3120:Magea6'
ID 263201
Institutional Source Beutler Lab
Gene Symbol Magea6
Ensembl Gene ENSMUSG00000063728
Gene Name melanoma antigen, family A, 6
Synonyms Mage-a6
MMRRC Submission 040593-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock # R3120 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 154924012-154935987 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 154924295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 255 (I255N)
Ref Sequence ENSEMBL: ENSMUSP00000108181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076986] [ENSMUST00000112562]
AlphaFold O89010
Predicted Effect probably benign
Transcript: ENSMUST00000076986
AA Change: I255N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076250
Gene: ENSMUSG00000063728
AA Change: I255N

DomainStartEndE-ValueType
Pfam:MAGE_N 5 82 4.9e-8 PFAM
MAGE 103 273 6.77e-101 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112562
AA Change: I255N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108181
Gene: ENSMUSG00000063728
AA Change: I255N

DomainStartEndE-ValueType
Pfam:MAGE_N 5 84 1.5e-15 PFAM
Pfam:MAGE 103 273 1.5e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bsx A G 9: 40,877,612 K155R possibly damaging Het
Ccdc39 T C 3: 33,837,838 K162E probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dnah1 G A 14: 31,266,822 R3351* probably null Het
Eml1 A G 12: 108,513,053 R362G probably benign Het
Fam222b T C 11: 78,153,916 L101P probably damaging Het
Fars2 A G 13: 36,246,417 E276G probably damaging Het
Gatad1 G T 5: 3,641,456 Y33* probably null Het
Gclc A C 9: 77,781,270 E219A possibly damaging Het
Gm4846 A G 1: 166,491,548 V207A probably benign Het
Hbq1a T C 11: 32,300,472 L87P probably damaging Het
Hist1h1b A T 13: 21,780,045 S170R probably benign Het
Mfsd12 T G 10: 81,361,215 V206G probably benign Het
Mis18bp1 T C 12: 65,156,988 probably null Het
Nf1 C A 11: 79,564,899 T550K probably damaging Het
Nlrp4f T C 13: 65,194,716 T372A probably benign Het
Olfr495 T C 7: 108,395,723 I201T possibly damaging Het
Pkdcc T C 17: 83,220,037 Y215H probably damaging Het
Plekha5 A G 6: 140,591,641 T253A probably benign Het
Polr2f T A 15: 79,144,588 probably null Het
Prph2 C T 17: 46,923,372 A289V possibly damaging Het
Ptdss2 C T 7: 141,152,219 H140Y probably damaging Het
Rlf T A 4: 121,149,483 I877L probably benign Het
Scgb2b2 T C 7: 31,303,576 L32S possibly damaging Het
Sfpq T A 4: 127,022,133 H239Q unknown Het
St6gal2 A T 17: 55,482,110 R48S probably benign Het
Sybu T C 15: 44,672,959 D657G possibly damaging Het
Syt15 A G 14: 34,222,993 I166V probably benign Het
Taar7f C A 10: 24,049,580 T24K probably benign Het
Tbcd T C 11: 121,608,648 S1093P probably damaging Het
Tfap2c G A 2: 172,557,095 V396M possibly damaging Het
Tnxb C T 17: 34,692,355 T1544I possibly damaging Het
Trim28 A G 7: 13,028,414 T322A probably damaging Het
Tubgcp3 G A 8: 12,657,626 A121V possibly damaging Het
Vmn2r14 A T 5: 109,224,565 W20R probably null Het
Zfp551 A G 7: 12,416,016 F489L possibly damaging Het
Other mutations in Magea6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02519:Magea6 APN X 154924745 missense probably benign 0.00
IGL03281:Magea6 APN X 154924627 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAGAAATTGGAGCATCTGC -3'
(R):5'- ATGCCCAAGACAGGTATCCTC -3'

Sequencing Primer
(F):5'- ATCTGCTCAAGATCCAAGCCTTGG -3'
(R):5'- AGGTATCCTCATAGCTGTACTGAG -3'
Posted On 2015-02-05