Mutagenetix > Incidental Mutations

Incidental Mutation 'R3121:Slc2a2'

263209

Institutional Source

Beutler Lab

Gene Symbol

Slc2a2

Ensembl Gene

ENSMUSG00000027690

Gene Name

solute carrier family 2 (facilitated glucose transporter), member 2

Synonyms

Glut2, liver-type glucose transporter, Glut-2

MMRRC Submission

040594-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3121 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28697903-28731359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28721749 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 336 (Q336R)

Ref Sequence

ENSEMBL: ENSMUSP00000029240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]

Predicted Effect

probably benign
Transcript: ENSMUST00000029240
AA Change: Q336R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: Q336R

Domain	Start	End	E-Value	Type
Pfam:MFS_1	9	442	4.2e-23	PFAM
Pfam:Sugar_tr	13	498	2.4e-165	PFAM
Pfam:Folate_carrier	187	458	5.3e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163536

SMART Domains

Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690

Domain	Start	End	E-Value	Type
Pfam:Sugar_tr	13	133	3.9e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167704

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169047

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080O16Rik	A	T	X: 51,969,091	Y239*	probably null	Het
2310035C23Rik	A	G	1: 105,725,799	N834S	probably benign	Het
2810403A07Rik	A	G	3: 88,689,292	T127A	probably damaging	Het
2810474O19Rik	T	A	6: 149,329,243	C1262*	probably null	Het
Abcg5	A	T	17: 84,658,663	M423K	probably benign	Het
Adamtsl1	T	A	4: 86,337,009	W780R	probably damaging	Het
Ago3	A	G	4: 126,417,372	I16T	probably benign	Het
Amph	T	A	13: 19,113,146	L354*	probably null	Het
Ankk1	G	A	9: 49,426,967	L9F	probably benign	Het
BC080695	T	A	4: 143,571,013	M1K	probably null	Het
Brdt	A	G	5: 107,377,145	T851A	probably damaging	Het
Bzw2	A	C	12: 36,120,789		probably null	Het
Capn7	A	T	14: 31,359,210	I395F	probably damaging	Het
Ccdc146	T	C	5: 21,294,593	R864G	possibly damaging	Het
Ccdc50	G	T	16: 27,409,389	R102L	possibly damaging	Het
Cep83	T	C	10: 94,786,838	V592A	probably damaging	Het
Cgn	G	A	3: 94,778,482		probably benign	Het
Cidec	C	A	6: 113,428,125	V195L	probably benign	Het
Cntln	A	G	4: 85,005,052		probably benign	Het
Cntrob	A	T	11: 69,322,700	L88*	probably null	Het
Dnah17	C	T	11: 118,041,086	V3687M	probably damaging	Het
Dst	T	C	1: 34,289,648	I4599T	probably damaging	Het
Dtl	A	T	1: 191,553,063	Y320*	probably null	Het
Fam98b	A	G	2: 117,267,927	T293A	probably damaging	Het
Farp1	G	A	14: 121,222,726		probably benign	Het
Fat2	G	T	11: 55,311,796	P151T	probably damaging	Het
Fbxl17	A	T	17: 63,471,424	M497K	probably damaging	Het
Foxn4	T	C	5: 114,258,715	T236A	probably damaging	Het
Gm525	C	T	11: 89,088,548		probably benign	Het
Golga4	C	A	9: 118,557,380	T1190K	possibly damaging	Het
H2-T23	T	A	17: 36,030,963	M248L	probably benign	Het
Homez	T	C	14: 54,857,321	E310G	probably benign	Het
Hydin	A	G	8: 110,506,506	I1746V	probably benign	Het
Igkv1-35	T	A	6: 70,011,657	H6L	probably benign	Het
Kcnt2	T	C	1: 140,428,884	S354P	probably damaging	Het
Klra4	G	T	6: 130,063,178	Q44K	probably benign	Het
L3mbtl3	A	G	10: 26,344,221		probably benign	Het
Lamb1	C	T	12: 31,287,529	R372C	probably damaging	Het
Map3k9	A	G	12: 81,743,924	I285T	probably damaging	Het
Olfr1256	T	A	2: 89,835,514	I144L	probably benign	Het
Olfr782	A	G	10: 129,350,683	N40S	possibly damaging	Het
Pcdhb16	A	T	18: 37,478,218	Q77L	possibly damaging	Het
Proser3	A	G	7: 30,540,371	V436A	probably benign	Het
Sec24b	C	T	3: 130,002,304		probably null	Het
Sowahb	T	C	5: 93,043,402	D486G	possibly damaging	Het
Spidr	T	C	16: 16,140,860	K13E	probably damaging	Het
Tiam2	T	A	17: 3,439,702	M786K	probably benign	Het
Tktl2	T	A	8: 66,512,156	V122E	probably damaging	Het
Wapl	A	G	14: 34,729,215	I729M	possibly damaging	Het
Zbbx	T	C	3: 75,081,846	T317A	possibly damaging	Het
Zfp976	A	G	7: 42,613,514	C300R	probably damaging	Het

Other mutations in Slc2a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Slc2a2	APN	3	28718741	missense	possibly damaging	0.86
IGL01582:Slc2a2	APN	3	28708488	missense	probably benign	0.01
IGL01762:Slc2a2	APN	3	28717472	missense	probably damaging	1.00
IGL01942:Slc2a2	APN	3	28705803	missense	probably damaging	1.00
IGL02128:Slc2a2	APN	3	28719401	missense	probably damaging	1.00
IGL02218:Slc2a2	APN	3	28698025	missense	possibly damaging	0.94
IGL02278:Slc2a2	APN	3	28717455	missense	probably damaging	0.99
IGL02507:Slc2a2	APN	3	28727111	missense	probably benign	0.00
IGL02649:Slc2a2	APN	3	28718736	missense	probably damaging	0.97
IGL03323:Slc2a2	APN	3	28726290	missense	probably damaging	1.00
IGL03147:Slc2a2	UTSW	3	28719370	missense	possibly damaging	0.56
R0063:Slc2a2	UTSW	3	28717440	missense	probably damaging	0.98
R0063:Slc2a2	UTSW	3	28717440	missense	probably damaging	0.98
R0365:Slc2a2	UTSW	3	28708679	critical splice donor site	probably null
R0494:Slc2a2	UTSW	3	28727277	missense	probably benign	0.01
R0519:Slc2a2	UTSW	3	28718816	missense	possibly damaging	0.54
R1292:Slc2a2	UTSW	3	28717488	missense	probably damaging	1.00
R1755:Slc2a2	UTSW	3	28713662	splice site	probably null
R1965:Slc2a2	UTSW	3	28719485	missense	probably damaging	1.00
R1966:Slc2a2	UTSW	3	28719485	missense	probably damaging	1.00
R1982:Slc2a2	UTSW	3	28717441	missense	probably benign	0.36
R2937:Slc2a2	UTSW	3	28718771	missense	probably damaging	1.00
R3721:Slc2a2	UTSW	3	28727152	missense	probably damaging	1.00
R4799:Slc2a2	UTSW	3	28717532	critical splice donor site	probably null
R5206:Slc2a2	UTSW	3	28708607	missense	probably damaging	1.00
R6829:Slc2a2	UTSW	3	28727441	nonsense	probably null
R6864:Slc2a2	UTSW	3	28721725	missense	probably damaging	1.00
R6932:Slc2a2	UTSW	3	28717519	missense	probably benign	0.40
R7178:Slc2a2	UTSW	3	28719482	missense	possibly damaging	0.90
R7599:Slc2a2	UTSW	3	28698017	start codon destroyed	probably null	0.02
R7616:Slc2a2	UTSW	3	28727111	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCAGGAGCTTTAAACACTGG -3'
(R):5'- CTCTTATGTCACATACACACGC -3'

Sequencing Primer
(F):5'- ACACTGGTGAAAGACTTGTCTG -3'
(R):5'- CAGTGCACGTGGACAAAGTTG -3'

Posted On

2015-02-05