Incidental Mutation 'R3121:Cntln'
ID 263215
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 040594-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R3121 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 84923289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,966,091 (GRCm39) M423K probably benign Het
Adamtsl1 T A 4: 86,255,246 (GRCm39) W780R probably damaging Het
Ago3 A G 4: 126,311,165 (GRCm39) I16T probably benign Het
Amph T A 13: 19,297,316 (GRCm39) L354* probably null Het
Ankk1 G A 9: 49,338,267 (GRCm39) L9F probably benign Het
Brdt A G 5: 107,525,011 (GRCm39) T851A probably damaging Het
Bzw2 A C 12: 36,170,788 (GRCm39) probably null Het
Capn7 A T 14: 31,081,167 (GRCm39) I395F probably damaging Het
Ccdc146 T C 5: 21,499,591 (GRCm39) R864G possibly damaging Het
Ccdc50 G T 16: 27,228,139 (GRCm39) R102L possibly damaging Het
Cep83 T C 10: 94,622,700 (GRCm39) V592A probably damaging Het
Cgn G A 3: 94,685,792 (GRCm39) probably benign Het
Cidec C A 6: 113,405,086 (GRCm39) V195L probably benign Het
Cntrob A T 11: 69,213,526 (GRCm39) L88* probably null Het
Dnah17 C T 11: 117,931,912 (GRCm39) V3687M probably damaging Het
Dst T C 1: 34,328,729 (GRCm39) I4599T probably damaging Het
Dtl A T 1: 191,285,175 (GRCm39) Y320* probably null Het
Fam98b A G 2: 117,098,408 (GRCm39) T293A probably damaging Het
Farp1 G A 14: 121,460,138 (GRCm39) probably benign Het
Fat2 G T 11: 55,202,622 (GRCm39) P151T probably damaging Het
Fbxl17 A T 17: 63,778,419 (GRCm39) M497K probably damaging Het
Foxn4 T C 5: 114,396,776 (GRCm39) T236A probably damaging Het
Gm525 C T 11: 88,979,374 (GRCm39) probably benign Het
Golga4 C A 9: 118,386,448 (GRCm39) T1190K possibly damaging Het
H2-T23 T A 17: 36,341,855 (GRCm39) M248L probably benign Het
Homez T C 14: 55,094,778 (GRCm39) E310G probably benign Het
Hydin A G 8: 111,233,138 (GRCm39) I1746V probably benign Het
Igkv1-35 T A 6: 69,988,641 (GRCm39) H6L probably benign Het
Kcnt2 T C 1: 140,356,622 (GRCm39) S354P probably damaging Het
Khdc4 A G 3: 88,596,599 (GRCm39) T127A probably damaging Het
Klra4 G T 6: 130,040,141 (GRCm39) Q44K probably benign Het
L3mbtl3 A G 10: 26,220,119 (GRCm39) probably benign Het
Lamb1 C T 12: 31,337,528 (GRCm39) R372C probably damaging Het
Magea14 A T X: 51,057,968 (GRCm39) Y239* probably null Het
Map3k9 A G 12: 81,790,698 (GRCm39) I285T probably damaging Het
Or4a47 T A 2: 89,665,858 (GRCm39) I144L probably benign Het
Or6c6 A G 10: 129,186,552 (GRCm39) N40S possibly damaging Het
Pcdhb16 A T 18: 37,611,271 (GRCm39) Q77L possibly damaging Het
Pramel20 T A 4: 143,297,583 (GRCm39) M1K probably null Het
Proser3 A G 7: 30,239,796 (GRCm39) V436A probably benign Het
Relch A G 1: 105,653,524 (GRCm39) N834S probably benign Het
Resf1 T A 6: 149,230,741 (GRCm39) C1262* probably null Het
Sec24b C T 3: 129,795,953 (GRCm39) probably null Het
Slc2a2 A G 3: 28,775,898 (GRCm39) Q336R probably benign Het
Sowahb T C 5: 93,191,261 (GRCm39) D486G possibly damaging Het
Spidr T C 16: 15,958,724 (GRCm39) K13E probably damaging Het
Tiam2 T A 17: 3,489,977 (GRCm39) M786K probably benign Het
Tktl2 T A 8: 66,964,808 (GRCm39) V122E probably damaging Het
Wapl A G 14: 34,451,172 (GRCm39) I729M possibly damaging Het
Zbbx T C 3: 74,989,153 (GRCm39) T317A possibly damaging Het
Zfp976 A G 7: 42,262,938 (GRCm39) C300R probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCCTAGATGAGTGATTTTAGGAG -3'
(R):5'- ACCTTCTGCCAGTGACATCTG -3'

Sequencing Primer
(F):5'- GAGTGATTTTAGGAGAATGAGATCAG -3'
(R):5'- CTGCCAGTGACATCTGTAAATG -3'
Posted On 2015-02-05