Incidental Mutation 'R3121:Cntln'
ID263215
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Namecentlein, centrosomal protein
SynonymsB430108F07Rik, D530005L17Rik
MMRRC Submission 040594-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R3121 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location84884309-85131921 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 85005052 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
Predicted Effect probably benign
Transcript: ENSMUST00000047023
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik A T X: 51,969,091 Y239* probably null Het
2310035C23Rik A G 1: 105,725,799 N834S probably benign Het
2810403A07Rik A G 3: 88,689,292 T127A probably damaging Het
2810474O19Rik T A 6: 149,329,243 C1262* probably null Het
Abcg5 A T 17: 84,658,663 M423K probably benign Het
Adamtsl1 T A 4: 86,337,009 W780R probably damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Amph T A 13: 19,113,146 L354* probably null Het
Ankk1 G A 9: 49,426,967 L9F probably benign Het
BC080695 T A 4: 143,571,013 M1K probably null Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Bzw2 A C 12: 36,120,789 probably null Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc50 G T 16: 27,409,389 R102L possibly damaging Het
Cep83 T C 10: 94,786,838 V592A probably damaging Het
Cgn G A 3: 94,778,482 probably benign Het
Cidec C A 6: 113,428,125 V195L probably benign Het
Cntrob A T 11: 69,322,700 L88* probably null Het
Dnah17 C T 11: 118,041,086 V3687M probably damaging Het
Dst T C 1: 34,289,648 I4599T probably damaging Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Fam98b A G 2: 117,267,927 T293A probably damaging Het
Farp1 G A 14: 121,222,726 probably benign Het
Fat2 G T 11: 55,311,796 P151T probably damaging Het
Fbxl17 A T 17: 63,471,424 M497K probably damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm525 C T 11: 89,088,548 probably benign Het
Golga4 C A 9: 118,557,380 T1190K possibly damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Homez T C 14: 54,857,321 E310G probably benign Het
Hydin A G 8: 110,506,506 I1746V probably benign Het
Igkv1-35 T A 6: 70,011,657 H6L probably benign Het
Kcnt2 T C 1: 140,428,884 S354P probably damaging Het
Klra4 G T 6: 130,063,178 Q44K probably benign Het
L3mbtl3 A G 10: 26,344,221 probably benign Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Map3k9 A G 12: 81,743,924 I285T probably damaging Het
Olfr1256 T A 2: 89,835,514 I144L probably benign Het
Olfr782 A G 10: 129,350,683 N40S possibly damaging Het
Pcdhb16 A T 18: 37,478,218 Q77L possibly damaging Het
Proser3 A G 7: 30,540,371 V436A probably benign Het
Sec24b C T 3: 130,002,304 probably null Het
Slc2a2 A G 3: 28,721,749 Q336R probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Spidr T C 16: 16,140,860 K13E probably damaging Het
Tiam2 T A 17: 3,439,702 M786K probably benign Het
Tktl2 T A 8: 66,512,156 V122E probably damaging Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Zbbx T C 3: 75,081,846 T317A possibly damaging Het
Zfp976 A G 7: 42,613,514 C300R probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0110:Cntln UTSW 4 85096757 missense probably damaging 1.00
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
R7670:Cntln UTSW 4 84979340 missense possibly damaging 0.66
R7707:Cntln UTSW 4 84884616 missense probably damaging 1.00
R7895:Cntln UTSW 4 85063324 missense possibly damaging 0.91
R8176:Cntln UTSW 4 84888689 missense probably damaging 0.99
R8247:Cntln UTSW 4 85100780 missense probably benign 0.39
R8264:Cntln UTSW 4 85098411 missense probably damaging 1.00
R8293:Cntln UTSW 4 85033838 missense probably damaging 1.00
R8536:Cntln UTSW 4 84957049 missense probably damaging 1.00
R8844:Cntln UTSW 4 84973997 missense probably damaging 1.00
R8924:Cntln UTSW 4 84888699 missense probably damaging 1.00
R8955:Cntln UTSW 4 85067873 missense possibly damaging 0.85
R8960:Cntln UTSW 4 85100724 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- ATCCCTAGATGAGTGATTTTAGGAG -3'
(R):5'- ACCTTCTGCCAGTGACATCTG -3'

Sequencing Primer
(F):5'- GAGTGATTTTAGGAGAATGAGATCAG -3'
(R):5'- CTGCCAGTGACATCTGTAAATG -3'
Posted On2015-02-05