Mutagenetix > Incidental Mutations

Incidental Mutation 'R3121:Ago3'

263217

Institutional Source

Beutler Lab

Gene Symbol

Ago3

Ensembl Gene

ENSMUSG00000028842

Gene Name

argonaute RISC catalytic subunit 3

Synonyms

eIF2C3, argonaute 3, C130014L07Rik

MMRRC Submission

040594-MU

Accession Numbers

Genbank: NM_153402; MGI: 2446634

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3121 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126331704-126429556 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126417372 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 16 (I16T)

Ref Sequence

ENSEMBL: ENSMUSP00000066633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069097]

Predicted Effect

probably benign
Transcript: ENSMUST00000069097
AA Change: I16T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: I16T

Domain	Start	End	E-Value	Type
Pfam:ArgoN	20	167	9.4e-26	PFAM
DUF1785	176	228	3.48e-25	SMART
PAZ	236	371	4.18e-4	SMART
Pfam:ArgoL2	376	421	1.3e-14	PFAM
Pfam:ArgoMid	430	512	1.4e-34	PFAM
Piwi	518	819	2.96e-136	SMART
Blast:Piwi	826	852	5e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123233

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080O16Rik	A	T	X: 51,969,091	Y239*	probably null	Het
2310035C23Rik	A	G	1: 105,725,799	N834S	probably benign	Het
2810403A07Rik	A	G	3: 88,689,292	T127A	probably damaging	Het
2810474O19Rik	T	A	6: 149,329,243	C1262*	probably null	Het
Abcg5	A	T	17: 84,658,663	M423K	probably benign	Het
Adamtsl1	T	A	4: 86,337,009	W780R	probably damaging	Het
Amph	T	A	13: 19,113,146	L354*	probably null	Het
Ankk1	G	A	9: 49,426,967	L9F	probably benign	Het
BC080695	T	A	4: 143,571,013	M1K	probably null	Het
Brdt	A	G	5: 107,377,145	T851A	probably damaging	Het
Bzw2	A	C	12: 36,120,789		probably null	Het
Capn7	A	T	14: 31,359,210	I395F	probably damaging	Het
Ccdc146	T	C	5: 21,294,593	R864G	possibly damaging	Het
Ccdc50	G	T	16: 27,409,389	R102L	possibly damaging	Het
Cep83	T	C	10: 94,786,838	V592A	probably damaging	Het
Cgn	G	A	3: 94,778,482		probably benign	Het
Cidec	C	A	6: 113,428,125	V195L	probably benign	Het
Cntln	A	G	4: 85,005,052		probably benign	Het
Cntrob	A	T	11: 69,322,700	L88*	probably null	Het
Dnah17	C	T	11: 118,041,086	V3687M	probably damaging	Het
Dst	T	C	1: 34,289,648	I4599T	probably damaging	Het
Dtl	A	T	1: 191,553,063	Y320*	probably null	Het
Fam98b	A	G	2: 117,267,927	T293A	probably damaging	Het
Farp1	G	A	14: 121,222,726		probably benign	Het
Fat2	G	T	11: 55,311,796	P151T	probably damaging	Het
Fbxl17	A	T	17: 63,471,424	M497K	probably damaging	Het
Foxn4	T	C	5: 114,258,715	T236A	probably damaging	Het
Gm525	C	T	11: 89,088,548		probably benign	Het
Golga4	C	A	9: 118,557,380	T1190K	possibly damaging	Het
H2-T23	T	A	17: 36,030,963	M248L	probably benign	Het
Homez	T	C	14: 54,857,321	E310G	probably benign	Het
Hydin	A	G	8: 110,506,506	I1746V	probably benign	Het
Igkv1-35	T	A	6: 70,011,657	H6L	probably benign	Het
Kcnt2	T	C	1: 140,428,884	S354P	probably damaging	Het
Klra4	G	T	6: 130,063,178	Q44K	probably benign	Het
L3mbtl3	A	G	10: 26,344,221		probably benign	Het
Lamb1	C	T	12: 31,287,529	R372C	probably damaging	Het
Map3k9	A	G	12: 81,743,924	I285T	probably damaging	Het
Olfr1256	T	A	2: 89,835,514	I144L	probably benign	Het
Olfr782	A	G	10: 129,350,683	N40S	possibly damaging	Het
Pcdhb16	A	T	18: 37,478,218	Q77L	possibly damaging	Het
Proser3	A	G	7: 30,540,371	V436A	probably benign	Het
Sec24b	C	T	3: 130,002,304		probably null	Het
Slc2a2	A	G	3: 28,721,749	Q336R	probably benign	Het
Sowahb	T	C	5: 93,043,402	D486G	possibly damaging	Het
Spidr	T	C	16: 16,140,860	K13E	probably damaging	Het
Tiam2	T	A	17: 3,439,702	M786K	probably benign	Het
Tktl2	T	A	8: 66,512,156	V122E	probably damaging	Het
Wapl	A	G	14: 34,729,215	I729M	possibly damaging	Het
Zbbx	T	C	3: 75,081,846	T317A	possibly damaging	Het
Zfp976	A	G	7: 42,613,514	C300R	probably damaging	Het

Other mutations in Ago3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Ago3	APN	4	126371541	missense	probably damaging	1.00
IGL01826:Ago3	APN	4	126403282	missense	probably damaging	1.00
IGL02285:Ago3	APN	4	126350877	missense	possibly damaging	0.88
IGL02869:Ago3	APN	4	126367787	splice site	probably benign
IGL03068:Ago3	APN	4	126417378	missense	probably damaging	0.99
D4043:Ago3	UTSW	4	126351003	missense	probably damaging	1.00
R0506:Ago3	UTSW	4	126417252	missense	possibly damaging	0.79
R0545:Ago3	UTSW	4	126417232	missense	probably damaging	1.00
R0764:Ago3	UTSW	4	126355092	missense	possibly damaging	0.82
R1445:Ago3	UTSW	4	126371787	missense	probably benign
R1706:Ago3	UTSW	4	126370292	missense	probably damaging	1.00
R1909:Ago3	UTSW	4	126346737	missense	probably damaging	1.00
R1944:Ago3	UTSW	4	126353727	missense	probably damaging	1.00
R1974:Ago3	UTSW	4	126346751	missense	probably damaging	1.00
R2239:Ago3	UTSW	4	126368522	missense	probably damaging	1.00
R2380:Ago3	UTSW	4	126368522	missense	probably damaging	1.00
R2424:Ago3	UTSW	4	126404247	missense	probably damaging	1.00
R2571:Ago3	UTSW	4	126363811	missense	probably damaging	1.00
R3122:Ago3	UTSW	4	126417372	missense	probably benign
R4022:Ago3	UTSW	4	126368593	missense	probably benign	0.31
R4079:Ago3	UTSW	4	126353680	critical splice donor site	probably null
R4272:Ago3	UTSW	4	126355091	missense	possibly damaging	0.95
R4533:Ago3	UTSW	4	126345563	missense	probably damaging	1.00
R4575:Ago3	UTSW	4	126346682	missense	probably benign	0.06
R4656:Ago3	UTSW	4	126363752	nonsense	probably null
R4782:Ago3	UTSW	4	126347872	splice site	probably null
R4783:Ago3	UTSW	4	126368503	missense	probably benign	0.31
R4784:Ago3	UTSW	4	126368503	missense	probably benign	0.31
R4785:Ago3	UTSW	4	126368503	missense	probably benign	0.31
R4799:Ago3	UTSW	4	126347872	splice site	probably null
R5013:Ago3	UTSW	4	126368598	missense	probably benign	0.18
R5180:Ago3	UTSW	4	126367751	missense	probably benign	0.01
R5692:Ago3	UTSW	4	126355069	unclassified	probably null
R5801:Ago3	UTSW	4	126371768	missense	possibly damaging	0.53
R5955:Ago3	UTSW	4	126355050	missense	probably damaging	1.00
R6730:Ago3	UTSW	4	126371545	missense	probably null	0.04
R7077:Ago3	UTSW	4	126371532	missense	probably null	0.01
R7123:Ago3	UTSW	4	126355005	critical splice donor site	probably null
R7125:Ago3	UTSW	4	126370352	missense	probably null	0.89
R7354:Ago3	UTSW	4	126417306	missense	possibly damaging	0.72
R7472:Ago3	UTSW	4	126345517	missense	probably damaging	1.00
R7522:Ago3	UTSW	4	126363807	missense	probably benign	0.00
R7863:Ago3	UTSW	4	126350197	missense	possibly damaging	0.53
R8163:Ago3	UTSW	4	126368584	missense	probably benign	0.10
R8225:Ago3	UTSW	4	126353739	missense	probably damaging	1.00
R8266:Ago3	UTSW	4	126376928	nonsense	probably null
R8269:Ago3	UTSW	4	126376928	nonsense	probably null
T0722:Ago3	UTSW	4	126404263	missense	probably benign
T0722:Ago3	UTSW	4	126404296	missense	probably benign	0.21
T0722:Ago3	UTSW	4	126404305	missense	probably benign
T0722:Ago3	UTSW	4	126404310	missense	probably benign	0.00
T0975:Ago3	UTSW	4	126404263	missense	probably benign
T0975:Ago3	UTSW	4	126404305	missense	probably benign
T0975:Ago3	UTSW	4	126404310	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAGCTAAACTCCACGGTTCTC -3'
(R):5'- CACTGGCTTACTTGAGTTTGC -3'

Sequencing Primer
(F):5'- AAACTCCACGGTTCTCACCTG -3'
(R):5'- CCTTTCCAGAGCATAGTTGTTTG -3'

Posted On

2015-02-05