Incidental Mutation 'R3121:Brdt'
ID263221
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Namebromodomain, testis-specific
SynonymsFsrg3, 7420412D09Rik, Brd6
MMRRC Submission 040594-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3121 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107331159-107387058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107377145 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 851 (T851A)
Ref Sequence ENSEMBL: ENSMUSP00000031215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215]
PDB Structure
Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000031215
AA Change: T851A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: T851A

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162804
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik A T X: 51,969,091 Y239* probably null Het
2310035C23Rik A G 1: 105,725,799 N834S probably benign Het
2810403A07Rik A G 3: 88,689,292 T127A probably damaging Het
2810474O19Rik T A 6: 149,329,243 C1262* probably null Het
Abcg5 A T 17: 84,658,663 M423K probably benign Het
Adamtsl1 T A 4: 86,337,009 W780R probably damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Amph T A 13: 19,113,146 L354* probably null Het
Ankk1 G A 9: 49,426,967 L9F probably benign Het
BC080695 T A 4: 143,571,013 M1K probably null Het
Bzw2 A C 12: 36,120,789 probably null Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc50 G T 16: 27,409,389 R102L possibly damaging Het
Cep83 T C 10: 94,786,838 V592A probably damaging Het
Cgn G A 3: 94,778,482 probably benign Het
Cidec C A 6: 113,428,125 V195L probably benign Het
Cntln A G 4: 85,005,052 probably benign Het
Cntrob A T 11: 69,322,700 L88* probably null Het
Dnah17 C T 11: 118,041,086 V3687M probably damaging Het
Dst T C 1: 34,289,648 I4599T probably damaging Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Fam98b A G 2: 117,267,927 T293A probably damaging Het
Farp1 G A 14: 121,222,726 probably benign Het
Fat2 G T 11: 55,311,796 P151T probably damaging Het
Fbxl17 A T 17: 63,471,424 M497K probably damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm525 C T 11: 89,088,548 probably benign Het
Golga4 C A 9: 118,557,380 T1190K possibly damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Homez T C 14: 54,857,321 E310G probably benign Het
Hydin A G 8: 110,506,506 I1746V probably benign Het
Igkv1-35 T A 6: 70,011,657 H6L probably benign Het
Kcnt2 T C 1: 140,428,884 S354P probably damaging Het
Klra4 G T 6: 130,063,178 Q44K probably benign Het
L3mbtl3 A G 10: 26,344,221 probably benign Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Map3k9 A G 12: 81,743,924 I285T probably damaging Het
Olfr1256 T A 2: 89,835,514 I144L probably benign Het
Olfr782 A G 10: 129,350,683 N40S possibly damaging Het
Pcdhb16 A T 18: 37,478,218 Q77L possibly damaging Het
Proser3 A G 7: 30,540,371 V436A probably benign Het
Sec24b C T 3: 130,002,304 probably null Het
Slc2a2 A G 3: 28,721,749 Q336R probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Spidr T C 16: 16,140,860 K13E probably damaging Het
Tiam2 T A 17: 3,439,702 M786K probably benign Het
Tktl2 T A 8: 66,512,156 V122E probably damaging Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Zbbx T C 3: 75,081,846 T317A possibly damaging Het
Zfp976 A G 7: 42,613,514 C300R probably damaging Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107342203 missense probably damaging 1.00
IGL02718:Brdt APN 5 107350068 splice site probably benign
IGL02746:Brdt APN 5 107370324 missense probably benign
IGL02851:Brdt APN 5 107377995 missense possibly damaging 0.47
R0585:Brdt UTSW 5 107356882 critical splice donor site probably null
R0708:Brdt UTSW 5 107358900 nonsense probably null
R1338:Brdt UTSW 5 107350188 missense probably benign 0.02
R1710:Brdt UTSW 5 107343584 missense probably damaging 1.00
R1794:Brdt UTSW 5 107359853 small deletion probably benign
R1861:Brdt UTSW 5 107359458 missense probably benign
R1913:Brdt UTSW 5 107348613 missense probably benign
R2029:Brdt UTSW 5 107359224 missense probably benign 0.35
R2431:Brdt UTSW 5 107378015 synonymous probably null
R3122:Brdt UTSW 5 107377145 missense probably damaging 0.99
R4258:Brdt UTSW 5 107359909 missense probably damaging 0.97
R4609:Brdt UTSW 5 107359936 missense probably benign 0.00
R5306:Brdt UTSW 5 107345144 missense probably damaging 1.00
R5640:Brdt UTSW 5 107359308 nonsense probably null
R5677:Brdt UTSW 5 107348617 missense possibly damaging 0.85
R5936:Brdt UTSW 5 107359395 missense probably damaging 1.00
R6145:Brdt UTSW 5 107377999 missense possibly damaging 0.67
R6261:Brdt UTSW 5 107348503 missense probably benign 0.04
R6408:Brdt UTSW 5 107385492 missense probably damaging 1.00
R6930:Brdt UTSW 5 107359215 missense probably benign 0.35
R7372:Brdt UTSW 5 107370294 missense possibly damaging 0.49
R7741:Brdt UTSW 5 107358886 missense probably benign 0.00
R7842:Brdt UTSW 5 107348588 missense possibly damaging 0.49
R7869:Brdt UTSW 5 107370179 missense probably benign 0.04
R7887:Brdt UTSW 5 107359933 missense possibly damaging 0.66
R7925:Brdt UTSW 5 107348588 missense possibly damaging 0.49
R7952:Brdt UTSW 5 107370179 missense probably benign 0.04
R8064:Brdt UTSW 5 107377996 nonsense probably null
X0011:Brdt UTSW 5 107342128 missense probably damaging 0.96
X0011:Brdt UTSW 5 107377092 missense probably damaging 1.00
Z1176:Brdt UTSW 5 107359898 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TCTGATTGACATCTAACATAGGCTG -3'
(R):5'- ATGCTTGGAAGACAGTTCAGG -3'

Sequencing Primer
(F):5'- GTTTAGGGAAGCCAGTGAA -3'
(R):5'- TGTAATGACAATTTGTTGTGTGTTC -3'
Posted On2015-02-05