Incidental Mutation 'R3121:Ankk1'
ID263231
Institutional Source Beutler Lab
Gene Symbol Ankk1
Ensembl Gene ENSMUSG00000032257
Gene Nameankyrin repeat and kinase domain containing 1
Synonyms9930020N01Rik
MMRRC Submission 040594-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3121 (G1)
Quality Score171
Status Validated
Chromosome9
Chromosomal Location49415194-49427021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49426967 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 9 (L9F)
Ref Sequence ENSEMBL: ENSMUSP00000034792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034792]
Predicted Effect probably benign
Transcript: ENSMUST00000034792
AA Change: L9F

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034792
Gene: ENSMUSG00000032257
AA Change: L9F

DomainStartEndE-ValueType
Pfam:Pkinase 35 298 4.1e-44 PFAM
Pfam:Pkinase_Tyr 36 297 7.6e-47 PFAM
ANK 369 398 1.36e-2 SMART
ANK 402 431 4.13e-2 SMART
ANK 435 464 3.51e-5 SMART
ANK 468 497 5.62e-4 SMART
ANK 501 530 5.71e-5 SMART
ANK 534 563 1.05e-3 SMART
ANK 567 596 1.12e-3 SMART
ANK 600 629 6.12e-5 SMART
ANK 633 662 1.59e-3 SMART
ANK 666 695 3.65e-3 SMART
ANK 699 728 8.39e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and protein kinase superfamily involved in signal transduction pathways. This gene is closely linked to DRD2 gene (GeneID:1813) on chr 11, and a well studied restriction fragment length polymorphism (RFLP) designated TaqIA, was originally associated with the DRD2 gene, however, later was determined to be located in exon 8 of ANKK1 gene (PMIDs: 18621654, 15146457), where it causes a nonconservative amino acid substitution. It is not clear if this gene plays any role in neuropsychiatric disorders previously associated with Taq1A RFLP. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik A T X: 51,969,091 Y239* probably null Het
2310035C23Rik A G 1: 105,725,799 N834S probably benign Het
2810403A07Rik A G 3: 88,689,292 T127A probably damaging Het
2810474O19Rik T A 6: 149,329,243 C1262* probably null Het
Abcg5 A T 17: 84,658,663 M423K probably benign Het
Adamtsl1 T A 4: 86,337,009 W780R probably damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Amph T A 13: 19,113,146 L354* probably null Het
BC080695 T A 4: 143,571,013 M1K probably null Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Bzw2 A C 12: 36,120,789 probably null Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc50 G T 16: 27,409,389 R102L possibly damaging Het
Cep83 T C 10: 94,786,838 V592A probably damaging Het
Cgn G A 3: 94,778,482 probably benign Het
Cidec C A 6: 113,428,125 V195L probably benign Het
Cntln A G 4: 85,005,052 probably benign Het
Cntrob A T 11: 69,322,700 L88* probably null Het
Dnah17 C T 11: 118,041,086 V3687M probably damaging Het
Dst T C 1: 34,289,648 I4599T probably damaging Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Fam98b A G 2: 117,267,927 T293A probably damaging Het
Farp1 G A 14: 121,222,726 probably benign Het
Fat2 G T 11: 55,311,796 P151T probably damaging Het
Fbxl17 A T 17: 63,471,424 M497K probably damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm525 C T 11: 89,088,548 probably benign Het
Golga4 C A 9: 118,557,380 T1190K possibly damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Homez T C 14: 54,857,321 E310G probably benign Het
Hydin A G 8: 110,506,506 I1746V probably benign Het
Igkv1-35 T A 6: 70,011,657 H6L probably benign Het
Kcnt2 T C 1: 140,428,884 S354P probably damaging Het
Klra4 G T 6: 130,063,178 Q44K probably benign Het
L3mbtl3 A G 10: 26,344,221 probably benign Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Map3k9 A G 12: 81,743,924 I285T probably damaging Het
Olfr1256 T A 2: 89,835,514 I144L probably benign Het
Olfr782 A G 10: 129,350,683 N40S possibly damaging Het
Pcdhb16 A T 18: 37,478,218 Q77L possibly damaging Het
Proser3 A G 7: 30,540,371 V436A probably benign Het
Sec24b C T 3: 130,002,304 probably null Het
Slc2a2 A G 3: 28,721,749 Q336R probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Spidr T C 16: 16,140,860 K13E probably damaging Het
Tiam2 T A 17: 3,439,702 M786K probably benign Het
Tktl2 T A 8: 66,512,156 V122E probably damaging Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Zbbx T C 3: 75,081,846 T317A possibly damaging Het
Zfp976 A G 7: 42,613,514 C300R probably damaging Het
Other mutations in Ankk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ankk1 APN 9 49421900 missense probably benign 0.30
IGL00495:Ankk1 APN 9 49415843 missense probably benign 0.00
IGL01316:Ankk1 APN 9 49420484 unclassified probably benign
IGL01359:Ankk1 APN 9 49416028 missense possibly damaging 0.95
IGL01464:Ankk1 APN 9 49415972 missense probably benign 0.26
IGL01719:Ankk1 APN 9 49416781 missense probably benign 0.08
IGL02057:Ankk1 APN 9 49416772 missense probably damaging 1.00
IGL02549:Ankk1 APN 9 49418693 missense probably damaging 1.00
IGL02690:Ankk1 APN 9 49421900 missense probably damaging 0.99
IGL03083:Ankk1 APN 9 49421866 missense probably benign 0.15
IGL03168:Ankk1 APN 9 49415768 missense possibly damaging 0.89
IGL03289:Ankk1 APN 9 49415695 missense probably benign 0.00
R0319:Ankk1 UTSW 9 49416071 missense probably damaging 0.97
R0539:Ankk1 UTSW 9 49418030 missense probably benign
R0827:Ankk1 UTSW 9 49421737 missense possibly damaging 0.81
R1474:Ankk1 UTSW 9 49415839 missense probably damaging 1.00
R1818:Ankk1 UTSW 9 49420425 missense probably benign 0.06
R1851:Ankk1 UTSW 9 49415850 missense probably benign
R2044:Ankk1 UTSW 9 49419364 critical splice donor site probably null
R2088:Ankk1 UTSW 9 49421965 unclassified probably benign
R2353:Ankk1 UTSW 9 49418690 missense probably benign
R2897:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R2898:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R3714:Ankk1 UTSW 9 49421713 missense possibly damaging 0.92
R4455:Ankk1 UTSW 9 49418066 missense probably benign 0.00
R4757:Ankk1 UTSW 9 49415930 missense probably benign
R4893:Ankk1 UTSW 9 49415683 missense probably benign 0.00
R5090:Ankk1 UTSW 9 49421763 missense probably damaging 0.98
R5521:Ankk1 UTSW 9 49420448 missense probably benign 0.05
R5812:Ankk1 UTSW 9 49426853 missense probably benign 0.00
R5853:Ankk1 UTSW 9 49418695 missense possibly damaging 0.58
R5873:Ankk1 UTSW 9 49415896 missense probably benign 0.19
R6119:Ankk1 UTSW 9 49426883 missense possibly damaging 0.88
R6328:Ankk1 UTSW 9 49416071 missense possibly damaging 0.84
R6606:Ankk1 UTSW 9 49416346 missense probably benign 0.29
R6689:Ankk1 UTSW 9 49420476 missense probably damaging 1.00
R6745:Ankk1 UTSW 9 49416180 missense probably benign 0.00
R6856:Ankk1 UTSW 9 49420020 missense probably benign 0.39
R7424:Ankk1 UTSW 9 49418750 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGCACTTGATGGCGTACTGG -3'
(R):5'- TCTGACTTCCAGCTGCAAGC -3'

Sequencing Primer
(F):5'- ATGGCGTACTGGGTCCTC -3'
(R):5'- TGCAAGCACAGCTCTGG -3'
Posted On2015-02-05