Incidental Mutation 'R3121:Cntrob'
ID 263238
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 040594-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R3121 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 69213526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 88 (L88*)
Ref Sequence ENSEMBL: ENSMUSP00000122205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018614] [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect probably benign
Transcript: ENSMUST00000018614
SMART Domains Protein: ENSMUSP00000018614
Gene: ENSMUSG00000018470

DomainStartEndE-ValueType
low complexity region 23 49 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:Aldo_ket_red 92 396 1.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060956
SMART Domains Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 109 2.2e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092973
AA Change: L88*
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: L88*

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102601
SMART Domains Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102602
SMART Domains Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108662
SMART Domains Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 127 2.2e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123176
AA Change: L88*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176111
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,966,091 (GRCm39) M423K probably benign Het
Adamtsl1 T A 4: 86,255,246 (GRCm39) W780R probably damaging Het
Ago3 A G 4: 126,311,165 (GRCm39) I16T probably benign Het
Amph T A 13: 19,297,316 (GRCm39) L354* probably null Het
Ankk1 G A 9: 49,338,267 (GRCm39) L9F probably benign Het
Brdt A G 5: 107,525,011 (GRCm39) T851A probably damaging Het
Bzw2 A C 12: 36,170,788 (GRCm39) probably null Het
Capn7 A T 14: 31,081,167 (GRCm39) I395F probably damaging Het
Ccdc146 T C 5: 21,499,591 (GRCm39) R864G possibly damaging Het
Ccdc50 G T 16: 27,228,139 (GRCm39) R102L possibly damaging Het
Cep83 T C 10: 94,622,700 (GRCm39) V592A probably damaging Het
Cgn G A 3: 94,685,792 (GRCm39) probably benign Het
Cidec C A 6: 113,405,086 (GRCm39) V195L probably benign Het
Cntln A G 4: 84,923,289 (GRCm39) probably benign Het
Dnah17 C T 11: 117,931,912 (GRCm39) V3687M probably damaging Het
Dst T C 1: 34,328,729 (GRCm39) I4599T probably damaging Het
Dtl A T 1: 191,285,175 (GRCm39) Y320* probably null Het
Fam98b A G 2: 117,098,408 (GRCm39) T293A probably damaging Het
Farp1 G A 14: 121,460,138 (GRCm39) probably benign Het
Fat2 G T 11: 55,202,622 (GRCm39) P151T probably damaging Het
Fbxl17 A T 17: 63,778,419 (GRCm39) M497K probably damaging Het
Foxn4 T C 5: 114,396,776 (GRCm39) T236A probably damaging Het
Gm525 C T 11: 88,979,374 (GRCm39) probably benign Het
Golga4 C A 9: 118,386,448 (GRCm39) T1190K possibly damaging Het
H2-T23 T A 17: 36,341,855 (GRCm39) M248L probably benign Het
Homez T C 14: 55,094,778 (GRCm39) E310G probably benign Het
Hydin A G 8: 111,233,138 (GRCm39) I1746V probably benign Het
Igkv1-35 T A 6: 69,988,641 (GRCm39) H6L probably benign Het
Kcnt2 T C 1: 140,356,622 (GRCm39) S354P probably damaging Het
Khdc4 A G 3: 88,596,599 (GRCm39) T127A probably damaging Het
Klra4 G T 6: 130,040,141 (GRCm39) Q44K probably benign Het
L3mbtl3 A G 10: 26,220,119 (GRCm39) probably benign Het
Lamb1 C T 12: 31,337,528 (GRCm39) R372C probably damaging Het
Magea14 A T X: 51,057,968 (GRCm39) Y239* probably null Het
Map3k9 A G 12: 81,790,698 (GRCm39) I285T probably damaging Het
Or4a47 T A 2: 89,665,858 (GRCm39) I144L probably benign Het
Or6c6 A G 10: 129,186,552 (GRCm39) N40S possibly damaging Het
Pcdhb16 A T 18: 37,611,271 (GRCm39) Q77L possibly damaging Het
Pramel20 T A 4: 143,297,583 (GRCm39) M1K probably null Het
Proser3 A G 7: 30,239,796 (GRCm39) V436A probably benign Het
Relch A G 1: 105,653,524 (GRCm39) N834S probably benign Het
Resf1 T A 6: 149,230,741 (GRCm39) C1262* probably null Het
Sec24b C T 3: 129,795,953 (GRCm39) probably null Het
Slc2a2 A G 3: 28,775,898 (GRCm39) Q336R probably benign Het
Sowahb T C 5: 93,191,261 (GRCm39) D486G possibly damaging Het
Spidr T C 16: 15,958,724 (GRCm39) K13E probably damaging Het
Tiam2 T A 17: 3,489,977 (GRCm39) M786K probably benign Het
Tktl2 T A 8: 66,964,808 (GRCm39) V122E probably damaging Het
Wapl A G 14: 34,451,172 (GRCm39) I729M possibly damaging Het
Zbbx T C 3: 74,989,153 (GRCm39) T317A possibly damaging Het
Zfp976 A G 7: 42,262,938 (GRCm39) C300R probably damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAAATTATAGGTTTATGCCATTCCC -3'
(R):5'- TCCTGAGCGATTCGTCAGAG -3'

Sequencing Primer
(F):5'- GGTTTATGCCATTCCCTCAAAAG -3'
(R):5'- TTGAACCAGGTGTCCTCCGAG -3'
Posted On 2015-02-05