Incidental Mutation 'R3121:Capn7'
ID263246
Institutional Source Beutler Lab
Gene Symbol Capn7
Ensembl Gene ENSMUSG00000021893
Gene Namecalpain 7
SynonymsPalBH
MMRRC Submission 040594-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R3121 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31336638-31371986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31359210 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 395 (I395F)
Ref Sequence ENSEMBL: ENSMUSP00000119214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022451] [ENSMUST00000140002] [ENSMUST00000143472] [ENSMUST00000152182]
Predicted Effect probably damaging
Transcript: ENSMUST00000022451
AA Change: I395F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022451
Gene: ENSMUSG00000021893
AA Change: I395F

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 547 1.08e-91 SMART
Blast:CysPc 550 620 4e-39 BLAST
calpain_III 686 810 2.78e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140002
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143472
AA Change: I395F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118596
Gene: ENSMUSG00000021893
AA Change: I395F

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152182
AA Change: I395F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119214
Gene: ENSMUSG00000021893
AA Change: I395F

DomainStartEndE-ValueType
MIT 3 77 1.54e0 SMART
MIT 83 160 1.07e-17 SMART
CysPc 218 500 2.32e-50 SMART
Meta Mutation Damage Score 0.2647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The function of the protein encoded by this gene is not known. An orthologue has been found in mouse but it seems to diverge from other family members. The mouse orthologue is thought to be calcium independent with protease activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene frequently die before weaning. Survivors display reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik A T X: 51,969,091 Y239* probably null Het
2310035C23Rik A G 1: 105,725,799 N834S probably benign Het
2810403A07Rik A G 3: 88,689,292 T127A probably damaging Het
2810474O19Rik T A 6: 149,329,243 C1262* probably null Het
Abcg5 A T 17: 84,658,663 M423K probably benign Het
Adamtsl1 T A 4: 86,337,009 W780R probably damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Amph T A 13: 19,113,146 L354* probably null Het
Ankk1 G A 9: 49,426,967 L9F probably benign Het
BC080695 T A 4: 143,571,013 M1K probably null Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Bzw2 A C 12: 36,120,789 probably null Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Ccdc50 G T 16: 27,409,389 R102L possibly damaging Het
Cep83 T C 10: 94,786,838 V592A probably damaging Het
Cgn G A 3: 94,778,482 probably benign Het
Cidec C A 6: 113,428,125 V195L probably benign Het
Cntln A G 4: 85,005,052 probably benign Het
Cntrob A T 11: 69,322,700 L88* probably null Het
Dnah17 C T 11: 118,041,086 V3687M probably damaging Het
Dst T C 1: 34,289,648 I4599T probably damaging Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Fam98b A G 2: 117,267,927 T293A probably damaging Het
Farp1 G A 14: 121,222,726 probably benign Het
Fat2 G T 11: 55,311,796 P151T probably damaging Het
Fbxl17 A T 17: 63,471,424 M497K probably damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm525 C T 11: 89,088,548 probably benign Het
Golga4 C A 9: 118,557,380 T1190K possibly damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Homez T C 14: 54,857,321 E310G probably benign Het
Hydin A G 8: 110,506,506 I1746V probably benign Het
Igkv1-35 T A 6: 70,011,657 H6L probably benign Het
Kcnt2 T C 1: 140,428,884 S354P probably damaging Het
Klra4 G T 6: 130,063,178 Q44K probably benign Het
L3mbtl3 A G 10: 26,344,221 probably benign Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Map3k9 A G 12: 81,743,924 I285T probably damaging Het
Olfr1256 T A 2: 89,835,514 I144L probably benign Het
Olfr782 A G 10: 129,350,683 N40S possibly damaging Het
Pcdhb16 A T 18: 37,478,218 Q77L possibly damaging Het
Proser3 A G 7: 30,540,371 V436A probably benign Het
Sec24b C T 3: 130,002,304 probably null Het
Slc2a2 A G 3: 28,721,749 Q336R probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Spidr T C 16: 16,140,860 K13E probably damaging Het
Tiam2 T A 17: 3,439,702 M786K probably benign Het
Tktl2 T A 8: 66,512,156 V122E probably damaging Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Zbbx T C 3: 75,081,846 T317A possibly damaging Het
Zfp976 A G 7: 42,613,514 C300R probably damaging Het
Other mutations in Capn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Capn7 APN 14 31363578 missense probably benign 0.41
IGL01481:Capn7 APN 14 31355339 missense probably damaging 1.00
IGL03231:Capn7 APN 14 31355290 missense probably damaging 1.00
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0018:Capn7 UTSW 14 31354112 nonsense probably null
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0060:Capn7 UTSW 14 31365604 splice site probably benign
R0077:Capn7 UTSW 14 31368115 missense probably benign 0.10
R0195:Capn7 UTSW 14 31365581 missense probably damaging 1.00
R0316:Capn7 UTSW 14 31347809 missense probably benign 0.00
R0815:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R0863:Capn7 UTSW 14 31369757 missense possibly damaging 0.85
R1697:Capn7 UTSW 14 31360160 missense probably damaging 1.00
R1954:Capn7 UTSW 14 31360150 missense probably damaging 1.00
R2096:Capn7 UTSW 14 31349887 critical splice donor site probably null
R3122:Capn7 UTSW 14 31359210 missense probably damaging 1.00
R4409:Capn7 UTSW 14 31355339 missense probably damaging 1.00
R4676:Capn7 UTSW 14 31359259 missense possibly damaging 0.72
R4799:Capn7 UTSW 14 31360557 missense probably benign 0.01
R5023:Capn7 UTSW 14 31352426 missense probably damaging 0.99
R5129:Capn7 UTSW 14 31344511 missense probably damaging 0.99
R5460:Capn7 UTSW 14 31368203 critical splice donor site probably null
R5608:Capn7 UTSW 14 31370707 missense probably damaging 1.00
R5665:Capn7 UTSW 14 31369802 missense probably benign 0.00
R5786:Capn7 UTSW 14 31360145 missense probably damaging 1.00
R6186:Capn7 UTSW 14 31370918 missense probably damaging 1.00
R6190:Capn7 UTSW 14 31363603 missense probably benign 0.10
R6411:Capn7 UTSW 14 31340096 missense probably benign 0.00
R6514:Capn7 UTSW 14 31344554 missense probably benign 0.00
R6838:Capn7 UTSW 14 31354173 missense possibly damaging 0.95
R7041:Capn7 UTSW 14 31336685 unclassified probably benign
R7047:Capn7 UTSW 14 31336685 unclassified probably benign
R7124:Capn7 UTSW 14 31336685 unclassified probably benign
R7224:Capn7 UTSW 14 31370721 nonsense probably null
R7417:Capn7 UTSW 14 31370706 missense probably damaging 1.00
R7419:Capn7 UTSW 14 31349822 missense probably benign 0.02
R7544:Capn7 UTSW 14 31340050 missense probably damaging 1.00
R7699:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7700:Capn7 UTSW 14 31352444 missense probably benign 0.00
R7775:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7824:Capn7 UTSW 14 31352410 missense probably benign 0.00
R7908:Capn7 UTSW 14 31366245 critical splice donor site probably null
R7989:Capn7 UTSW 14 31366245 critical splice donor site probably null
R8057:Capn7 UTSW 14 31370979 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TTCCAGGTCAAATGAGGAGTGG -3'
(R):5'- ACAGCCTTGCTTACTTCAAAAGG -3'

Sequencing Primer
(F):5'- TCAAATGAGGAGTGGGTATCATACTG -3'
(R):5'- CTTCAAAAGGAAGTCGGAAGGG -3'
Posted On2015-02-05