Incidental Mutation 'R0324:Slc19a2'
ID26325
Institutional Source Beutler Lab
Gene Symbol Slc19a2
Ensembl Gene ENSMUSG00000040918
Gene Namesolute carrier family 19 (thiamine transporter), member 2
SynonymsTRMA, DDA1, THTR1
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location164249046-164265385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 164256775 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 78 (T78K)
Ref Sequence ENSEMBL: ENSMUSP00000123870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044021] [ENSMUST00000159230] [ENSMUST00000169394]
Predicted Effect probably damaging
Transcript: ENSMUST00000044021
AA Change: T78K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037561
Gene: ENSMUSG00000040918
AA Change: T78K

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 459 2.7e-180 PFAM
Pfam:MFS_1 34 441 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159230
AA Change: T78K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123870
Gene: ENSMUSG00000040918
AA Change: T78K

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 421 1.6e-176 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169394
SMART Domains Protein: ENSMUSP00000131327
Gene: ENSMUSG00000040918

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
Pfam:Folate_carrier 28 70 3.7e-17 PFAM
Pfam:Folate_carrier 65 258 6.7e-85 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the thiamin transporter protein. Mutations in this gene cause thiamin-responsive megaloblastic anemia syndrome (TRMA), which is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural deafness. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for targeted null alleles exhibit a grossly normal phenotype except for reduced testis size and male infertility. On a low-thiamine diet, mutants show premature death and sensorineural deafness, while homozygotes for one targeted allele also display diabetes mellitus and megaloblastosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Slc19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Slc19a2 APN 1 164260861 missense probably damaging 1.00
IGL03231:Slc19a2 APN 1 164260880 missense probably damaging 1.00
R0709:Slc19a2 UTSW 1 164256798 missense probably damaging 1.00
R1117:Slc19a2 UTSW 1 164263456 missense possibly damaging 0.86
R1165:Slc19a2 UTSW 1 164263445 missense probably damaging 1.00
R1463:Slc19a2 UTSW 1 164257197 missense probably damaging 0.98
R1833:Slc19a2 UTSW 1 164262184 missense probably damaging 1.00
R2148:Slc19a2 UTSW 1 164262088 missense probably damaging 1.00
R2680:Slc19a2 UTSW 1 164249413 missense probably damaging 1.00
R4010:Slc19a2 UTSW 1 164260882 missense probably damaging 1.00
R5850:Slc19a2 UTSW 1 164263456 missense probably benign 0.00
R6279:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6300:Slc19a2 UTSW 1 164256775 missense probably damaging 1.00
R6907:Slc19a2 UTSW 1 164262754 missense possibly damaging 0.79
R6917:Slc19a2 UTSW 1 164261009 missense probably damaging 1.00
R6982:Slc19a2 UTSW 1 164256859 missense possibly damaging 0.88
R6993:Slc19a2 UTSW 1 164260822 missense probably benign 0.00
R7424:Slc19a2 UTSW 1 164260876 missense probably benign 0.31
R7575:Slc19a2 UTSW 1 164257122 missense probably damaging 1.00
R8193:Slc19a2 UTSW 1 164257225 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGAAAGGCTACTCCAGGAGTTACC -3'
(R):5'- ATGCCCAGGTCCACCACAGTATAG -3'

Sequencing Primer
(F):5'- CCAGGAGTTACCTGAACTTACTGTG -3'
(R):5'- CAGGTCCACCACAGTATAGATATAGG -3'
Posted On2013-04-16