Incidental Mutation 'R3121:Ccdc50'
ID263252
Institutional Source Beutler Lab
Gene Symbol Ccdc50
Ensembl Gene ENSMUSG00000038127
Gene Namecoiled-coil domain containing 50
SynonymsD16Bwg1543e, 5730448P06Rik, 2610529H08Rik
MMRRC Submission 040594-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3121 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location27388869-27452218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27409389 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 102 (R102L)
Ref Sequence ENSEMBL: ENSMUSP00000097604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039443] [ENSMUST00000096127] [ENSMUST00000100026]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039443
AA Change: R102L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038509
Gene: ENSMUSG00000038127
AA Change: R102L

DomainStartEndE-ValueType
Pfam:CCDC50_N 1 131 2e-59 PFAM
low complexity region 211 225 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096127
AA Change: R102L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093841
Gene: ENSMUSG00000038127
AA Change: R102L

DomainStartEndE-ValueType
Pfam:CCDC50_N 1 131 1.8e-59 PFAM
coiled coil region 183 212 N/A INTRINSIC
low complexity region 223 234 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100026
AA Change: R102L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097604
Gene: ENSMUSG00000038127
AA Change: R102L

DomainStartEndE-ValueType
Pfam:CCDC50_N 4 128 1.5e-50 PFAM
low complexity region 211 225 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143823
AA Change: R103L

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118633
Gene: ENSMUSG00000038127
AA Change: R103L

DomainStartEndE-ValueType
Pfam:CCDC50_N 16 130 4.7e-44 PFAM
low complexity region 213 227 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080O16Rik A T X: 51,969,091 Y239* probably null Het
2310035C23Rik A G 1: 105,725,799 N834S probably benign Het
2810403A07Rik A G 3: 88,689,292 T127A probably damaging Het
2810474O19Rik T A 6: 149,329,243 C1262* probably null Het
Abcg5 A T 17: 84,658,663 M423K probably benign Het
Adamtsl1 T A 4: 86,337,009 W780R probably damaging Het
Ago3 A G 4: 126,417,372 I16T probably benign Het
Amph T A 13: 19,113,146 L354* probably null Het
Ankk1 G A 9: 49,426,967 L9F probably benign Het
BC080695 T A 4: 143,571,013 M1K probably null Het
Brdt A G 5: 107,377,145 T851A probably damaging Het
Bzw2 A C 12: 36,120,789 probably null Het
Capn7 A T 14: 31,359,210 I395F probably damaging Het
Ccdc146 T C 5: 21,294,593 R864G possibly damaging Het
Cep83 T C 10: 94,786,838 V592A probably damaging Het
Cgn G A 3: 94,778,482 probably benign Het
Cidec C A 6: 113,428,125 V195L probably benign Het
Cntln A G 4: 85,005,052 probably benign Het
Cntrob A T 11: 69,322,700 L88* probably null Het
Dnah17 C T 11: 118,041,086 V3687M probably damaging Het
Dst T C 1: 34,289,648 I4599T probably damaging Het
Dtl A T 1: 191,553,063 Y320* probably null Het
Fam98b A G 2: 117,267,927 T293A probably damaging Het
Farp1 G A 14: 121,222,726 probably benign Het
Fat2 G T 11: 55,311,796 P151T probably damaging Het
Fbxl17 A T 17: 63,471,424 M497K probably damaging Het
Foxn4 T C 5: 114,258,715 T236A probably damaging Het
Gm525 C T 11: 89,088,548 probably benign Het
Golga4 C A 9: 118,557,380 T1190K possibly damaging Het
H2-T23 T A 17: 36,030,963 M248L probably benign Het
Homez T C 14: 54,857,321 E310G probably benign Het
Hydin A G 8: 110,506,506 I1746V probably benign Het
Igkv1-35 T A 6: 70,011,657 H6L probably benign Het
Kcnt2 T C 1: 140,428,884 S354P probably damaging Het
Klra4 G T 6: 130,063,178 Q44K probably benign Het
L3mbtl3 A G 10: 26,344,221 probably benign Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Map3k9 A G 12: 81,743,924 I285T probably damaging Het
Olfr1256 T A 2: 89,835,514 I144L probably benign Het
Olfr782 A G 10: 129,350,683 N40S possibly damaging Het
Pcdhb16 A T 18: 37,478,218 Q77L possibly damaging Het
Proser3 A G 7: 30,540,371 V436A probably benign Het
Sec24b C T 3: 130,002,304 probably null Het
Slc2a2 A G 3: 28,721,749 Q336R probably benign Het
Sowahb T C 5: 93,043,402 D486G possibly damaging Het
Spidr T C 16: 16,140,860 K13E probably damaging Het
Tiam2 T A 17: 3,439,702 M786K probably benign Het
Tktl2 T A 8: 66,512,156 V122E probably damaging Het
Wapl A G 14: 34,729,215 I729M possibly damaging Het
Zbbx T C 3: 75,081,846 T317A possibly damaging Het
Zfp976 A G 7: 42,613,514 C300R probably damaging Het
Other mutations in Ccdc50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccdc50 APN 16 27409352 missense probably damaging 1.00
IGL02725:Ccdc50 APN 16 27436597 missense probably benign 0.38
IGL02742:Ccdc50 APN 16 27406784 splice site probably benign
R0310:Ccdc50 UTSW 16 27406658 missense probably damaging 1.00
R0582:Ccdc50 UTSW 16 27444659 splice site probably benign
R1993:Ccdc50 UTSW 16 27409339 nonsense probably null
R2844:Ccdc50 UTSW 16 27406729 missense probably damaging 1.00
R3923:Ccdc50 UTSW 16 27444544 missense probably damaging 1.00
R4624:Ccdc50 UTSW 16 27436601 missense probably null 0.77
R5057:Ccdc50 UTSW 16 27438342 missense probably benign 0.00
R5339:Ccdc50 UTSW 16 27417305 missense probably damaging 0.99
R7673:Ccdc50 UTSW 16 27406675 missense possibly damaging 0.84
R8355:Ccdc50 UTSW 16 27417351 missense probably benign 0.04
R8744:Ccdc50 UTSW 16 27436398 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTATTTGCCAGTGCCATGCAG -3'
(R):5'- CTCAATTGCATGTCAAGATTTCCC -3'

Sequencing Primer
(F):5'- CCAGTGCCATGCAGATTGAG -3'
(R):5'- TGCATGTCAAGATTTCCCCACAATAC -3'
Posted On2015-02-05