Incidental Mutation 'R2958:Tor4a'
ID263261
Institutional Source Beutler Lab
Gene Symbol Tor4a
Ensembl Gene ENSMUSG00000059555
Gene Nametorsin family 4, member A
Synonyms
MMRRC Submission 040519-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R2958 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25192966-25196886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25194968 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 308 (Q308K)
Ref Sequence ENSEMBL: ENSMUSP00000080548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059849] [ENSMUST00000081869] [ENSMUST00000137920] [ENSMUST00000142857]
Predicted Effect probably benign
Transcript: ENSMUST00000059849
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081869
AA Change: Q308K

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080548
Gene: ENSMUSG00000059555
AA Change: Q308K

DomainStartEndE-ValueType
low complexity region 21 40 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 81 93 N/A INTRINSIC
AAA 181 317 3.74e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect probably benign
Transcript: ENSMUST00000137920
Predicted Effect probably benign
Transcript: ENSMUST00000142857
SMART Domains Protein: ENSMUSP00000142048
Gene: ENSMUSG00000059555

DomainStartEndE-ValueType
Pfam:Torsin 1 86 4.2e-9 PFAM
Pfam:AAA_22 12 112 6.7e-8 PFAM
Pfam:AAA_17 18 111 2.4e-7 PFAM
Pfam:AAA 19 110 3.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205741
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,634,729 L1233Q probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cep78 C A 19: 15,978,909 R222L probably damaging Het
Eml5 T C 12: 98,876,178 I220M possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx5 A G 5: 120,435,477 N175S probably benign Het
Nrg3 G T 14: 39,472,712 A30E unknown Het
Numa1 C A 7: 102,009,495 R1663S possibly damaging Het
Nwd2 G A 5: 63,805,982 V970I probably benign Het
Olfr615 T C 7: 103,561,305 V276A possibly damaging Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Tdrd9 T C 12: 112,041,672 V982A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Tor4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Tor4a APN 2 25194798 missense probably benign 0.18
IGL02813:Tor4a APN 2 25194749 nonsense probably null
R1486:Tor4a UTSW 2 25194679 missense possibly damaging 0.47
R1916:Tor4a UTSW 2 25195402 missense possibly damaging 0.83
R5237:Tor4a UTSW 2 25194964 missense probably damaging 0.97
R5356:Tor4a UTSW 2 25195906 intron probably null
R5694:Tor4a UTSW 2 25194920 missense probably benign
R5874:Tor4a UTSW 2 25194835 missense probably damaging 1.00
R6314:Tor4a UTSW 2 25194782 missense possibly damaging 0.86
R6407:Tor4a UTSW 2 25194940 missense probably benign
R7056:Tor4a UTSW 2 25194841 missense probably benign
R7498:Tor4a UTSW 2 25195792 missense probably benign 0.22
R7590:Tor4a UTSW 2 25195798 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACATCCGGCTTGTCCAGTAG -3'
(R):5'- GATATCACTGTCCAGAGCCACG -3'

Sequencing Primer
(F):5'- CTTGTCCAGTAGCAGGAAGGGC -3'
(R):5'- GTTCAGGACTGCCGGAAG -3'
Posted On2015-02-05