Incidental Mutation 'R2958:Snx18'
ID263271
Institutional Source Beutler Lab
Gene Symbol Snx18
Ensembl Gene ENSMUSG00000042364
Gene Namesorting nexin 18
SynonymsSnag1
MMRRC Submission 040519-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R2958 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location113592179-113618564 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 113616886 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 504 (Q504*)
Ref Sequence ENSEMBL: ENSMUSP00000104864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109241]
Predicted Effect probably null
Transcript: ENSMUST00000109241
AA Change: Q504*
SMART Domains Protein: ENSMUSP00000104864
Gene: ENSMUSG00000042364
AA Change: Q504*

DomainStartEndE-ValueType
SH3 3 60 1.04e-14 SMART
low complexity region 61 76 N/A INTRINSIC
low complexity region 82 105 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
low complexity region 141 153 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
PX 264 373 8.75e-22 SMART
Pfam:BAR_3_WASP_bdg 377 613 7.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224883
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a SH3 domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,634,729 L1233Q probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cep78 C A 19: 15,978,909 R222L probably damaging Het
Eml5 T C 12: 98,876,178 I220M possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx5 A G 5: 120,435,477 N175S probably benign Het
Nrg3 G T 14: 39,472,712 A30E unknown Het
Numa1 C A 7: 102,009,495 R1663S possibly damaging Het
Nwd2 G A 5: 63,805,982 V970I probably benign Het
Olfr615 T C 7: 103,561,305 V276A possibly damaging Het
Tdrd9 T C 12: 112,041,672 V982A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tor4a G T 2: 25,194,968 Q308K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Snx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Snx18 APN 13 113617516 missense probably benign 0.13
IGL02068:Snx18 APN 13 113617065 missense probably damaging 1.00
IGL02195:Snx18 APN 13 113616840 missense probably damaging 0.99
IGL02541:Snx18 APN 13 113594766 missense probably damaging 0.98
R2419:Snx18 UTSW 13 113617219 missense possibly damaging 0.52
R3010:Snx18 UTSW 13 113616886 nonsense probably null
R3011:Snx18 UTSW 13 113616886 nonsense probably null
R4461:Snx18 UTSW 13 113617195 missense probably damaging 1.00
R4557:Snx18 UTSW 13 113617828 missense probably damaging 1.00
R4732:Snx18 UTSW 13 113617774 missense probably benign 0.04
R4733:Snx18 UTSW 13 113617774 missense probably benign 0.04
R5308:Snx18 UTSW 13 113616847 nonsense probably null
R6157:Snx18 UTSW 13 113617189 missense probably damaging 1.00
R6995:Snx18 UTSW 13 113594729 missense probably damaging 0.99
Z1177:Snx18 UTSW 13 113618145 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGAAACCCGGCAGTGGTATG -3'
(R):5'- TCACCAAGAAGATGGACGAC -3'

Sequencing Primer
(F):5'- AGTGGTATGCCTATCCAAGTCAC -3'
(R):5'- ATGGACGACAGTGCGTTGC -3'
Posted On2015-02-05