Mutagenetix > Incidental Mutation

Incidental Mutation 'R2958:Zfr'

263273

Institutional Source

Beutler Lab

Gene Symbol

Zfr

Ensembl Gene

ENSMUSG00000022201

Gene Name

zinc finger RNA binding protein

Synonyms

C920030H05Rik

MMRRC Submission

040519-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2958 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12117917-12185769 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12162319 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 823 (R823H)

Ref Sequence

ENSEMBL: ENSMUSP00000118911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122941]

AlphaFold

O88532

Predicted Effect

probably benign
Transcript: ENSMUST00000122941
AA Change: R823H

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: R823H

Domain	Start	End	E-Value	Type
low complexity region	69	116	N/A	INTRINSIC
low complexity region	159	182	N/A	INTRINSIC
low complexity region	196	224	N/A	INTRINSIC
low complexity region	229	302	N/A	INTRINSIC
ZnF_U1	328	362	7.79e-6	SMART
ZnF_C2H2	331	355	4.94e0	SMART
ZnF_U1	379	413	1.84e-7	SMART
ZnF_C2H2	382	406	4.65e-1	SMART
low complexity region	429	448	N/A	INTRINSIC
low complexity region	468	483	N/A	INTRINSIC
ZnF_U1	579	613	2.01e-8	SMART
ZnF_C2H2	582	606	1.31e0	SMART
low complexity region	630	664	N/A	INTRINSIC
low complexity region	685	719	N/A	INTRINSIC
low complexity region	766	782	N/A	INTRINSIC
DZF	784	1038	5.42e-170	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155054

SMART Domains

Protein: ENSMUSP00000114992
Gene: ENSMUSG00000022201

Domain	Start	End	E-Value	Type
low complexity region	19	53	N/A	INTRINSIC
PDB:4ATB\|D	56	94	6e-11	PDB
low complexity region	100	114	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000156752
AA Change: R95H

SMART Domains

Protein: ENSMUSP00000119251
Gene: ENSMUSG00000022201
AA Change: R95H

Domain	Start	End	E-Value	Type
low complexity region	34	52	N/A	INTRINSIC
DZF	57	299	1.79e-152	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000157034

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158625

Meta Mutation Damage Score

0.0717

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankhd1	T	A	18: 36,767,782 (GRCm39)	L1233Q	probably damaging	Het
Cdk5rap2	ATGTG	ATG	4: 70,208,214 (GRCm39)		probably null	Het
Cep78	C	A	19: 15,956,273 (GRCm39)	R222L	probably damaging	Het
Eml5	T	C	12: 98,842,437 (GRCm39)	I220M	possibly damaging	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Lhx5	A	G	5: 120,573,542 (GRCm39)	N175S	probably benign	Het
Nrg3	G	T	14: 39,194,669 (GRCm39)	A30E	unknown	Het
Numa1	C	A	7: 101,658,702 (GRCm39)	R1663S	possibly damaging	Het
Nwd2	G	A	5: 63,963,325 (GRCm39)	V970I	probably benign	Het
Or51ah3	T	C	7: 103,210,512 (GRCm39)	V276A	possibly damaging	Het
Snx18	G	A	13: 113,753,422 (GRCm39)	Q504*	probably null	Het
Tdrd9	T	C	12: 112,008,106 (GRCm39)	V982A	probably damaging	Het
Tex11	C	A	X: 99,977,021 (GRCm39)	A487S	possibly damaging	Het
Tor4a	G	T	2: 25,084,980 (GRCm39)	Q308K	possibly damaging	Het

Other mutations in Zfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Zfr	APN	15	12,159,732 (GRCm39)	missense	probably benign	0.26
IGL01759:Zfr	APN	15	12,159,741 (GRCm39)	missense	probably damaging	0.99
IGL01935:Zfr	APN	15	12,180,798 (GRCm39)	missense	probably benign	0.42
IGL02056:Zfr	APN	15	12,154,533 (GRCm39)	missense	probably damaging	1.00
IGL03009:Zfr	APN	15	12,162,321 (GRCm39)	missense	probably damaging	1.00
IGL03147:Zfr	UTSW	15	12,140,638 (GRCm39)	nonsense	probably null
PIT4504001:Zfr	UTSW	15	12,166,244 (GRCm39)	missense	possibly damaging	0.48
R0377:Zfr	UTSW	15	12,160,677 (GRCm39)	missense	probably benign	0.02
R0678:Zfr	UTSW	15	12,184,171 (GRCm39)	missense	probably damaging	1.00
R0783:Zfr	UTSW	15	12,162,268 (GRCm39)	missense	probably damaging	1.00
R0787:Zfr	UTSW	15	12,140,634 (GRCm39)	missense	unknown
R1464:Zfr	UTSW	15	12,146,458 (GRCm39)	missense	probably damaging	1.00
R1464:Zfr	UTSW	15	12,146,458 (GRCm39)	missense	probably damaging	1.00
R1538:Zfr	UTSW	15	12,150,329 (GRCm39)	missense	possibly damaging	0.61
R1558:Zfr	UTSW	15	12,140,730 (GRCm39)	missense	unknown
R1619:Zfr	UTSW	15	12,150,473 (GRCm39)	missense	possibly damaging	0.52
R1924:Zfr	UTSW	15	12,160,715 (GRCm39)	missense	possibly damaging	0.74
R2163:Zfr	UTSW	15	12,162,309 (GRCm39)	missense	probably damaging	1.00
R2960:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R2961:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R2962:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R2963:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R3012:Zfr	UTSW	15	12,166,249 (GRCm39)	missense	probably damaging	1.00
R3054:Zfr	UTSW	15	12,154,593 (GRCm39)	missense	probably damaging	1.00
R3429:Zfr	UTSW	15	12,153,006 (GRCm39)	missense	probably benign	0.00
R3611:Zfr	UTSW	15	12,159,848 (GRCm39)	critical splice donor site	probably null
R3825:Zfr	UTSW	15	12,166,277 (GRCm39)	missense	probably damaging	1.00
R3882:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R4080:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R4241:Zfr	UTSW	15	12,149,745 (GRCm39)	missense	probably damaging	1.00
R4366:Zfr	UTSW	15	12,156,416 (GRCm39)	missense	probably damaging	0.99
R4375:Zfr	UTSW	15	12,118,426 (GRCm39)	critical splice donor site	probably null
R4893:Zfr	UTSW	15	12,136,628 (GRCm39)	missense	unknown
R4899:Zfr	UTSW	15	12,166,231 (GRCm39)	missense	probably benign	0.11
R4915:Zfr	UTSW	15	12,162,198 (GRCm39)	critical splice acceptor site	probably null
R5870:Zfr	UTSW	15	12,160,701 (GRCm39)	missense	probably damaging	1.00
R6162:Zfr	UTSW	15	12,146,331 (GRCm39)	missense	unknown
R6163:Zfr	UTSW	15	12,146,331 (GRCm39)	missense	unknown
R6165:Zfr	UTSW	15	12,146,331 (GRCm39)	missense	unknown
R6187:Zfr	UTSW	15	12,146,317 (GRCm39)	small deletion	probably benign
R6251:Zfr	UTSW	15	12,160,677 (GRCm39)	missense	probably benign	0.02
R6903:Zfr	UTSW	15	12,136,541 (GRCm39)	missense	unknown
R6959:Zfr	UTSW	15	12,150,409 (GRCm39)	missense	probably damaging	1.00
R7133:Zfr	UTSW	15	12,180,724 (GRCm39)	missense	probably damaging	1.00
R7167:Zfr	UTSW	15	12,181,015 (GRCm39)	missense	probably benign	0.01
R7212:Zfr	UTSW	15	12,146,309 (GRCm39)	nonsense	probably null
R7373:Zfr	UTSW	15	12,140,645 (GRCm39)	missense	unknown
R7489:Zfr	UTSW	15	12,153,068 (GRCm39)	missense	probably benign	0.24
R7602:Zfr	UTSW	15	12,159,763 (GRCm39)	missense	possibly damaging	0.56
R7623:Zfr	UTSW	15	12,160,614 (GRCm39)	missense	possibly damaging	0.83
R7896:Zfr	UTSW	15	12,146,463 (GRCm39)	missense	probably damaging	1.00
R8188:Zfr	UTSW	15	12,171,904 (GRCm39)	missense	probably damaging	1.00
R8289:Zfr	UTSW	15	12,135,357 (GRCm39)	missense	noncoding transcript
R8382:Zfr	UTSW	15	12,153,054 (GRCm39)	nonsense	probably null
R8475:Zfr	UTSW	15	12,150,455 (GRCm39)	missense	probably benign	0.08
R9124:Zfr	UTSW	15	12,136,757 (GRCm39)	missense	unknown
R9493:Zfr	UTSW	15	12,180,706 (GRCm39)	critical splice acceptor site	probably null
R9598:Zfr	UTSW	15	12,162,292 (GRCm39)	missense	probably damaging	0.99
R9631:Zfr	UTSW	15	12,154,628 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGAGGAAATTACAGTTCTGGTTGAAG -3'
(R):5'- GACAAATTACAGTACTGCAGATCCTC -3'

Sequencing Primer
(F):5'- GGATTACTTCTCCGAGGA -3'
(R):5'- GGTGTGTGTACAAAACCAAAACC -3'

Posted On

2015-02-05