Incidental Mutation 'R2958:Cep78'
ID263276
Institutional Source Beutler Lab
Gene Symbol Cep78
Ensembl Gene ENSMUSG00000041491
Gene Namecentrosomal protein 78
Synonyms5730599I05Rik
MMRRC Submission 040519-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R2958 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location15955774-15984989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 15978909 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 222 (R222L)
Ref Sequence ENSEMBL: ENSMUSP00000037596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047704]
Predicted Effect probably damaging
Transcript: ENSMUST00000047704
AA Change: R222L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037596
Gene: ENSMUSG00000041491
AA Change: R222L

DomainStartEndE-ValueType
LRR 152 179 2.95e-3 SMART
Blast:LRR 180 207 1e-10 BLAST
LRR 231 259 6.28e-1 SMART
LRR 260 287 8.81e-2 SMART
LRR 288 313 1.96e2 SMART
low complexity region 427 450 N/A INTRINSIC
coiled coil region 462 511 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,634,729 L1233Q probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Eml5 T C 12: 98,876,178 I220M possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx5 A G 5: 120,435,477 N175S probably benign Het
Nrg3 G T 14: 39,472,712 A30E unknown Het
Numa1 C A 7: 102,009,495 R1663S possibly damaging Het
Nwd2 G A 5: 63,805,982 V970I probably benign Het
Olfr615 T C 7: 103,561,305 V276A possibly damaging Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Tdrd9 T C 12: 112,041,672 V982A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tor4a G T 2: 25,194,968 Q308K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Cep78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cep78 APN 19 15969140 missense probably benign
IGL00920:Cep78 APN 19 15981486 missense probably benign 0.03
IGL01548:Cep78 APN 19 15981200 splice site probably benign
IGL01662:Cep78 APN 19 15960995 missense probably damaging 1.00
IGL01933:Cep78 APN 19 15955940 missense probably benign
IGL02014:Cep78 APN 19 15984738 missense probably damaging 1.00
IGL02198:Cep78 APN 19 15956369 missense probably damaging 1.00
IGL02331:Cep78 APN 19 15974415 missense probably benign 0.16
IGL02431:Cep78 APN 19 15959579 missense probably benign
IGL02731:Cep78 APN 19 15956306 missense probably benign 0.02
IGL03268:Cep78 APN 19 15974442 nonsense probably null
IGL03338:Cep78 APN 19 15959623 missense probably damaging 0.97
himalayas UTSW 19 15969128 missense possibly damaging 0.66
R0426:Cep78 UTSW 19 15970970 nonsense probably null
R0619:Cep78 UTSW 19 15978862 missense probably damaging 0.99
R0659:Cep78 UTSW 19 15956190 missense probably damaging 0.97
R1517:Cep78 UTSW 19 15959663 missense probably damaging 1.00
R1758:Cep78 UTSW 19 15959536 missense probably damaging 1.00
R1836:Cep78 UTSW 19 15969169 missense probably damaging 1.00
R1865:Cep78 UTSW 19 15956004 missense probably damaging 1.00
R1920:Cep78 UTSW 19 15974351 splice site probably benign
R2483:Cep78 UTSW 19 15960980 missense probably damaging 1.00
R3814:Cep78 UTSW 19 15981802 critical splice acceptor site probably null
R4133:Cep78 UTSW 19 15969155 missense probably damaging 1.00
R4214:Cep78 UTSW 19 15959579 missense probably benign
R5783:Cep78 UTSW 19 15956359 missense probably benign 0.02
R5791:Cep78 UTSW 19 15961072 missense probably benign 0.19
R5910:Cep78 UTSW 19 15969128 missense possibly damaging 0.66
R5924:Cep78 UTSW 19 15961066 missense probably damaging 1.00
R6148:Cep78 UTSW 19 15981786 nonsense probably null
R6162:Cep78 UTSW 19 15974940 missense probably benign 0.28
R6235:Cep78 UTSW 19 15976486 intron probably null
R6968:Cep78 UTSW 19 15981738 missense probably benign 0.38
R7228:Cep78 UTSW 19 15969197 missense probably benign 0.01
R7913:Cep78 UTSW 19 15970577 missense probably benign
R7994:Cep78 UTSW 19 15970577 missense probably benign
R8059:Cep78 UTSW 19 15981512 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTCTGGAGAATATATGTGACTTCAGG -3'
(R):5'- CCTGTGACGGTTCATACAATCAAG -3'

Sequencing Primer
(F):5'- TAAAAGTACAGTAAAAGCTGCTACAG -3'
(R):5'- TACAATCAAGCCCTGTGGTG -3'
Posted On2015-02-05