Incidental Mutation 'R2967:Bola3'
ID263284
Institutional Source Beutler Lab
Gene Symbol Bola3
Ensembl Gene ENSMUSG00000045160
Gene NamebolA-like 3 (E. coli)
Synonyms
MMRRC Submission 040523-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R2967 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83349147-83360136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83349298 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 24 (Y24N)
Ref Sequence ENSEMBL: ENSMUSP00000112582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120040] [ENSMUST00000122216] [ENSMUST00000136501]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055875
Predicted Effect probably benign
Transcript: ENSMUST00000120040
AA Change: Y24N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112582
Gene: ENSMUSG00000045160
AA Change: Y24N

DomainStartEndE-ValueType
Pfam:BolA 60 135 4.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122216
SMART Domains Protein: ENSMUSP00000113439
Gene: ENSMUSG00000045160

DomainStartEndE-ValueType
Pfam:BolA 26 94 7.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134765
Predicted Effect probably benign
Transcript: ENSMUST00000136501
SMART Domains Protein: ENSMUSP00000118348
Gene: ENSMUSG00000045160

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Pfam:BolA 41 109 4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151329
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an essential role in the production of iron-sulfur (Fe-S) clusters for the normal maturation of lipoate-containing 2-oxoacid dehydrogenases, and for the assembly of the mitochondrial respiratory chain complexes. Mutation in this gene has been associated with multiple mitochondrial dysfunctions syndrome-2. Two alternatively spliced transcript variants encoding different isoforms with distinct subcellular localization have been reported for this gene (PMID:21944046). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,166,070 S185G possibly damaging Het
Adgra1 G A 7: 139,875,685 E410K possibly damaging Het
Aox2 A T 1: 58,322,834 N733I probably damaging Het
Cntn6 G A 6: 104,726,237 V135I probably benign Het
Eif2s3y A T Y: 1,020,030 M353L probably benign Het
Ercc8 C A 13: 108,160,714 P53T probably damaging Het
Gan A G 8: 117,183,526 K65E probably damaging Het
Gm1110 T C 9: 26,881,043 E597G probably benign Het
Gm15448 T A 7: 3,822,687 R394S probably damaging Het
Gsdmc4 T A 15: 63,902,060 H81L probably benign Het
Hs2st1 T A 3: 144,465,138 N91I probably damaging Het
Olfr391-ps A G 11: 73,799,107 S217P possibly damaging Het
Olfr57 A T 10: 79,035,053 I86F probably damaging Het
Pgr T C 9: 8,901,818 S451P possibly damaging Het
Pwp2 A G 10: 78,182,698 L84S possibly damaging Het
Rab1a T A 11: 20,223,068 probably null Het
Secisbp2 T C 13: 51,670,879 S388P probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sybu T C 15: 44,746,356 K172R probably damaging Het
Topbp1 C T 9: 103,342,140 A1197V probably benign Het
Ttf1 T A 2: 29,065,383 V253D possibly damaging Het
Ugt2a2 A T 5: 87,474,629 V160E probably damaging Het
Vmn1r81 G T 7: 12,260,037 Q215K probably damaging Het
Zfp653 A G 9: 22,065,730 L147P probably damaging Het
Other mutations in Bola3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3975:Bola3 UTSW 6 83351267 missense probably benign 0.03
R3976:Bola3 UTSW 6 83351267 missense probably benign 0.03
R5425:Bola3 UTSW 6 83349552 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTCCGCCCTTTCTAGAAC -3'
(R):5'- ATCCGCCTAAGTCCAGTAGC -3'

Sequencing Primer
(F):5'- TTTCTAGAACACAAGACTCCGGTGG -3'
(R):5'- TAAGTCCAGTAGCCCCCAG -3'
Posted On2015-02-05