Incidental Mutation 'R2967:Vmn1r81'
ID263287
Institutional Source Beutler Lab
Gene Symbol Vmn1r81
Ensembl Gene ENSMUSG00000115027
Gene Namevomeronasal 1 receptor 81
SynonymsV1rg9
MMRRC Submission 040523-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R2967 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12247241-12268269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12260037 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 215 (Q215K)
Ref Sequence ENSEMBL: ENSMUSP00000153780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086232] [ENSMUST00000227080] [ENSMUST00000227973] [ENSMUST00000228482] [ENSMUST00000228764]
Predicted Effect probably damaging
Transcript: ENSMUST00000086232
AA Change: Q215K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083409
Gene: ENSMUSG00000115027
AA Change: Q215K

DomainStartEndE-ValueType
Pfam:TAS2R 3 301 5.4e-12 PFAM
Pfam:V1R 34 299 6.6e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227080
AA Change: Q215K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000227973
AA Change: Q215K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000228482
AA Change: Q215K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000228764
AA Change: Q215K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,166,070 S185G possibly damaging Het
Adgra1 G A 7: 139,875,685 E410K possibly damaging Het
Aox2 A T 1: 58,322,834 N733I probably damaging Het
Bola3 T A 6: 83,349,298 Y24N probably benign Het
Cntn6 G A 6: 104,726,237 V135I probably benign Het
Eif2s3y A T Y: 1,020,030 M353L probably benign Het
Ercc8 C A 13: 108,160,714 P53T probably damaging Het
Gan A G 8: 117,183,526 K65E probably damaging Het
Gm1110 T C 9: 26,881,043 E597G probably benign Het
Gm15448 T A 7: 3,822,687 R394S probably damaging Het
Gsdmc4 T A 15: 63,902,060 H81L probably benign Het
Hs2st1 T A 3: 144,465,138 N91I probably damaging Het
Olfr391-ps A G 11: 73,799,107 S217P possibly damaging Het
Olfr57 A T 10: 79,035,053 I86F probably damaging Het
Pgr T C 9: 8,901,818 S451P possibly damaging Het
Pwp2 A G 10: 78,182,698 L84S possibly damaging Het
Rab1a T A 11: 20,223,068 probably null Het
Secisbp2 T C 13: 51,670,879 S388P probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sybu T C 15: 44,746,356 K172R probably damaging Het
Topbp1 C T 9: 103,342,140 A1197V probably benign Het
Ttf1 T A 2: 29,065,383 V253D possibly damaging Het
Ugt2a2 A T 5: 87,474,629 V160E probably damaging Het
Zfp653 A G 9: 22,065,730 L147P probably damaging Het
Other mutations in Vmn1r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vmn1r81 APN 7 12260505 missense probably damaging 1.00
IGL02086:Vmn1r81 APN 7 12259865 missense possibly damaging 0.82
IGL02751:Vmn1r81 APN 7 12260447 missense probably damaging 1.00
IGL02879:Vmn1r81 APN 7 12260392 missense probably benign 0.20
IGL03358:Vmn1r81 APN 7 12260305 missense possibly damaging 0.57
PIT4305001:Vmn1r81 UTSW 7 12260663 missense probably benign 0.01
R0359:Vmn1r81 UTSW 7 12259950 missense probably damaging 1.00
R1615:Vmn1r81 UTSW 7 12260514 missense probably damaging 1.00
R1938:Vmn1r81 UTSW 7 12260662 missense possibly damaging 0.67
R2983:Vmn1r81 UTSW 7 12260669 missense probably benign 0.02
R4549:Vmn1r81 UTSW 7 12259822 missense probably damaging 0.99
R5099:Vmn1r81 UTSW 7 12260321 missense possibly damaging 0.86
R5326:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R5542:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R6010:Vmn1r81 UTSW 7 12260422 missense possibly damaging 0.88
R6630:Vmn1r81 UTSW 7 12260657 nonsense probably null
R6724:Vmn1r81 UTSW 7 12260672 missense probably damaging 1.00
R6754:Vmn1r81 UTSW 7 12259847 missense probably damaging 0.98
R8198:Vmn1r81 UTSW 7 12259955 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCTATCTCTTTCCACAGAAGGG -3'
(R):5'- AGTGACAGTCCCCACTTACAG -3'

Sequencing Primer
(F):5'- TTCCACAGAAGGGTAAAAATAGTCTG -3'
(R):5'- GTCCCCACTTACAGCAAAAATGTG -3'
Posted On2015-02-05