Incidental Mutation 'R2967:Pgr'
ID263291
Institutional Source Beutler Lab
Gene Symbol Pgr
Ensembl Gene ENSMUSG00000031870
Gene Nameprogesterone receptor
Synonyms9930019P03Rik, ENSMUSG00000074510, PR-A, PR-B, PR, NR3C3
MMRRC Submission 040523-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R2967 (G1)
Quality Score156
Status Not validated
Chromosome9
Chromosomal Location8899833-8968611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8901818 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 451 (S451P)
Ref Sequence ENSEMBL: ENSMUSP00000140124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070463] [ENSMUST00000098986] [ENSMUST00000189181]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070463
AA Change: S451P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063562
Gene: ENSMUSG00000031870
AA Change: S451P

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098986
AA Change: S286P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096584
Gene: ENSMUSG00000031870
AA Change: S286P

DomainStartEndE-ValueType
low complexity region 79 100 N/A INTRINSIC
low complexity region 172 189 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
low complexity region 269 289 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C4 392 463 1.29e-29 SMART
low complexity region 538 546 N/A INTRINSIC
HOLI 548 712 3.21e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151080
Predicted Effect possibly damaging
Transcript: ENSMUST00000189181
AA Change: S451P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140124
Gene: ENSMUSG00000031870
AA Change: S451P

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null female mice are sterile and exhibit ovulatory defects, uterine hyperplasia, and impaired mammary development. Females lacking only isoform A are infertile but show normal mammary development, while females lacking only isoform B are fertile but present with mammary developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,166,070 S185G possibly damaging Het
Adgra1 G A 7: 139,875,685 E410K possibly damaging Het
Aox2 A T 1: 58,322,834 N733I probably damaging Het
Bola3 T A 6: 83,349,298 Y24N probably benign Het
Cntn6 G A 6: 104,726,237 V135I probably benign Het
Eif2s3y A T Y: 1,020,030 M353L probably benign Het
Ercc8 C A 13: 108,160,714 P53T probably damaging Het
Gan A G 8: 117,183,526 K65E probably damaging Het
Gm1110 T C 9: 26,881,043 E597G probably benign Het
Gm15448 T A 7: 3,822,687 R394S probably damaging Het
Gsdmc4 T A 15: 63,902,060 H81L probably benign Het
Hs2st1 T A 3: 144,465,138 N91I probably damaging Het
Olfr391-ps A G 11: 73,799,107 S217P possibly damaging Het
Olfr57 A T 10: 79,035,053 I86F probably damaging Het
Pwp2 A G 10: 78,182,698 L84S possibly damaging Het
Rab1a T A 11: 20,223,068 probably null Het
Secisbp2 T C 13: 51,670,879 S388P probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sybu T C 15: 44,746,356 K172R probably damaging Het
Topbp1 C T 9: 103,342,140 A1197V probably benign Het
Ttf1 T A 2: 29,065,383 V253D possibly damaging Het
Ugt2a2 A T 5: 87,474,629 V160E probably damaging Het
Vmn1r81 G T 7: 12,260,037 Q215K probably damaging Het
Zfp653 A G 9: 22,065,730 L147P probably damaging Het
Other mutations in Pgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Pgr APN 9 8903691 missense possibly damaging 0.71
IGL01772:Pgr APN 9 8946636 splice site probably benign
IGL01963:Pgr APN 9 8922668 missense probably damaging 0.97
IGL02033:Pgr APN 9 8965110 missense probably damaging 1.00
IGL02837:Pgr APN 9 8946638 splice site probably benign
IGL03070:Pgr APN 9 8903664 missense possibly damaging 0.86
IGL03300:Pgr APN 9 8961539 missense probably damaging 1.00
R0152:Pgr UTSW 9 8965022 missense probably benign 0.45
R0305:Pgr UTSW 9 8902087 splice site probably benign
R0317:Pgr UTSW 9 8965022 missense probably benign 0.45
R0467:Pgr UTSW 9 8900778 missense possibly damaging 0.92
R1673:Pgr UTSW 9 8902068 missense possibly damaging 0.71
R1711:Pgr UTSW 9 8922714 splice site probably null
R1928:Pgr UTSW 9 8903629 nonsense probably null
R1951:Pgr UTSW 9 8946953 splice site probably benign
R2023:Pgr UTSW 9 8958398 missense probably damaging 0.99
R2426:Pgr UTSW 9 8900717 missense probably damaging 0.98
R3105:Pgr UTSW 9 8958396 missense probably benign 0.02
R3440:Pgr UTSW 9 8922629 missense probably damaging 0.98
R3735:Pgr UTSW 9 8901533 missense probably damaging 0.99
R3947:Pgr UTSW 9 8961452 missense probably benign 0.25
R4398:Pgr UTSW 9 8903749 critical splice donor site probably null
R4497:Pgr UTSW 9 8958419 missense probably damaging 0.99
R4811:Pgr UTSW 9 8900843 nonsense probably null
R4907:Pgr UTSW 9 8947043 intron probably benign
R4996:Pgr UTSW 9 8900913 missense probably damaging 0.99
R5448:Pgr UTSW 9 8922637 missense probably benign 0.06
R5449:Pgr UTSW 9 8956343 missense possibly damaging 0.95
R5699:Pgr UTSW 9 8900599 start gained probably benign
R5764:Pgr UTSW 9 8900537 missense probably benign 0.00
R6057:Pgr UTSW 9 8902005 missense probably damaging 0.98
R6134:Pgr UTSW 9 8900739 missense possibly damaging 0.51
R6242:Pgr UTSW 9 8900979 missense probably benign
R6476:Pgr UTSW 9 8964838 intron probably null
R6508:Pgr UTSW 9 8956289 missense probably damaging 1.00
R6604:Pgr UTSW 9 8946866 missense possibly damaging 0.73
R6715:Pgr UTSW 9 8964999 missense possibly damaging 0.93
R7444:Pgr UTSW 9 8946882 missense probably damaging 1.00
X0066:Pgr UTSW 9 8900834 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGACGCCTGGCTTGAAGATC -3'
(R):5'- TAAGGTATGGCGGGTAGACC -3'

Sequencing Primer
(F):5'- TTGAAGATCAAGGAGGAGGAGG -3'
(R):5'- AGGCTGTCCTTGAGCACC -3'
Posted On2015-02-05