Mutagenetix > Incidental Mutation

Incidental Mutation 'R2967:Gm1110'

263293

Institutional Source

Beutler Lab

Gene Symbol

Gm1110

Ensembl Gene

ENSMUSG00000079644

Gene Name

predicted gene 1110

Synonyms

LOC382064

MMRRC Submission

040523-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R2967 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26879567-26923111 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 26881043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 597 (E597G)

Ref Sequence

ENSEMBL: ENSMUSP00000110916 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115261]

AlphaFold

F6Y113

Predicted Effect

probably benign
Transcript: ENSMUST00000115261
AA Change: E597G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000110916
Gene: ENSMUSG00000079644
AA Change: E597G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Glyco_hydro_35	55	368	2e-93	PFAM
Pfam:Glyco_hydro_42	70	229	1e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214847

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217197

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	G	5: 114,166,070	S185G	possibly damaging	Het
Adgra1	G	A	7: 139,875,685	E410K	possibly damaging	Het
Aox2	A	T	1: 58,322,834	N733I	probably damaging	Het
Bola3	T	A	6: 83,349,298	Y24N	probably benign	Het
Cntn6	G	A	6: 104,726,237	V135I	probably benign	Het
Eif2s3y	A	T	Y: 1,020,030	M353L	probably benign	Het
Ercc8	C	A	13: 108,160,714	P53T	probably damaging	Het
Gan	A	G	8: 117,183,526	K65E	probably damaging	Het
Gm15448	T	A	7: 3,822,687	R394S	probably damaging	Het
Gsdmc4	T	A	15: 63,902,060	H81L	probably benign	Het
Hs2st1	T	A	3: 144,465,138	N91I	probably damaging	Het
Olfr391-ps	A	G	11: 73,799,107	S217P	possibly damaging	Het
Olfr57	A	T	10: 79,035,053	I86F	probably damaging	Het
Pgr	T	C	9: 8,901,818	S451P	possibly damaging	Het
Pwp2	A	G	10: 78,182,698	L84S	possibly damaging	Het
Rab1a	T	A	11: 20,223,068		probably null	Het
Secisbp2	T	C	13: 51,670,879	S388P	probably benign	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Sybu	T	C	15: 44,746,356	K172R	probably damaging	Het
Topbp1	C	T	9: 103,342,140	A1197V	probably benign	Het
Ttf1	T	A	2: 29,065,383	V253D	possibly damaging	Het
Ugt2a2	A	T	5: 87,474,629	V160E	probably damaging	Het
Vmn1r81	G	T	7: 12,260,037	Q215K	probably damaging	Het
Zfp653	A	G	9: 22,065,730	L147P	probably damaging	Het

Other mutations in Gm1110

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00591:Gm1110	APN	9	26880874	nonsense	probably null
IGL01089:Gm1110	APN	9	26881860	missense	probably benign
IGL01631:Gm1110	APN	9	26897916	critical splice donor site	probably null
IGL02008:Gm1110	APN	9	26883230	missense	probably benign	0.09
IGL02331:Gm1110	APN	9	26913287	critical splice donor site	probably null
IGL02335:Gm1110	APN	9	26881763	missense	probably benign	0.00
IGL02550:Gm1110	APN	9	26881834	missense	probably benign	0.09
IGL02614:Gm1110	APN	9	26920714	missense	probably benign	0.11
IGL03409:Gm1110	APN	9	26896620	missense	probably benign	0.21
PIT4458001:Gm1110	UTSW	9	26880828	missense	probably benign	0.00
R0189:Gm1110	UTSW	9	26883218	missense	probably null	0.99
R0271:Gm1110	UTSW	9	26920666	missense	probably damaging	1.00
R1034:Gm1110	UTSW	9	26921350	missense	probably damaging	1.00
R1229:Gm1110	UTSW	9	26881806	missense	probably benign
R1355:Gm1110	UTSW	9	26883761	missense	probably benign	0.01
R1566:Gm1110	UTSW	9	26880870	missense	probably damaging	1.00
R1574:Gm1110	UTSW	9	26881126	splice site	probably benign
R1916:Gm1110	UTSW	9	26889638	missense	probably damaging	1.00
R2011:Gm1110	UTSW	9	26894258	missense	probably benign	0.01
R2214:Gm1110	UTSW	9	26902490	missense	probably benign	0.37
R2567:Gm1110	UTSW	9	26920696	missense	probably benign
R4271:Gm1110	UTSW	9	26895648	critical splice donor site	probably null
R4683:Gm1110	UTSW	9	26920594	missense	probably damaging	0.99
R4945:Gm1110	UTSW	9	26920595	missense	possibly damaging	0.46
R5015:Gm1110	UTSW	9	26881866	missense	probably benign	0.01
R5089:Gm1110	UTSW	9	26882387	missense	probably damaging	0.96
R5225:Gm1110	UTSW	9	26902478	missense	probably damaging	1.00
R5239:Gm1110	UTSW	9	26893570	missense	probably benign	0.00
R5395:Gm1110	UTSW	9	26889632	missense	probably benign
R5783:Gm1110	UTSW	9	26882336	missense	probably benign
R6045:Gm1110	UTSW	9	26883209	critical splice donor site	probably null
R6245:Gm1110	UTSW	9	26920747	missense	probably benign	0.04
R6357:Gm1110	UTSW	9	26914128	splice site	probably null
R6863:Gm1110	UTSW	9	26881064	missense	probably damaging	1.00
R7336:Gm1110	UTSW	9	26914357	missense	probably damaging	0.99
R7454:Gm1110	UTSW	9	26920649	missense	probably benign
R7555:Gm1110	UTSW	9	26893628	missense	probably benign	0.05
R7579:Gm1110	UTSW	9	26883826	missense	possibly damaging	0.93
R7990:Gm1110	UTSW	9	26880841	missense	possibly damaging	0.66
R8062:Gm1110	UTSW	9	26881821	missense	probably damaging	0.99
R8108:Gm1110	UTSW	9	26920661	missense	probably damaging	1.00
R8323:Gm1110	UTSW	9	26902423	critical splice donor site	probably null
R8354:Gm1110	UTSW	9	26883280	missense	probably benign	0.01
R8354:Gm1110	UTSW	9	26883281	missense	probably benign	0.00
R8454:Gm1110	UTSW	9	26883280	missense	probably benign	0.01
R8454:Gm1110	UTSW	9	26883281	missense	probably benign	0.00
R8494:Gm1110	UTSW	9	26880858	missense	probably benign	0.04
R8978:Gm1110	UTSW	9	26895799	splice site	probably benign
R9321:Gm1110	UTSW	9	26920595	missense	probably benign	0.00
R9513:Gm1110	UTSW	9	26883787	missense	possibly damaging	0.95
R9545:Gm1110	UTSW	9	26889681	missense	probably benign	0.00
R9758:Gm1110	UTSW	9	26889598	nonsense	probably null
RF002:Gm1110	UTSW	9	26920640	missense	probably damaging	1.00
X0063:Gm1110	UTSW	9	26894280	missense	probably benign	0.01
Z1088:Gm1110	UTSW	9	26913310	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCATACCTAGTTGAGCCTTGG -3'
(R):5'- CCTGTCTTGGTCTATGCTAAGG -3'

Sequencing Primer
(F):5'- ACCTAGTTGAGCCTTGGTTGAAAAG -3'
(R):5'- CTATGCTAAGGATTGGTGTGTCAC -3'

Posted On

2015-02-05