Incidental Mutation 'R2967:Pwp2'
ID263295
Institutional Source Beutler Lab
Gene Symbol Pwp2
Ensembl Gene ENSMUSG00000032834
Gene NamePWP2 periodic tryptophan protein homolog (yeast)
SynonymsPwp2, Pwp2h, 6530411D08Rik
MMRRC Submission 040523-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R2967 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78170909-78185149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78182698 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 84 (L84S)
Ref Sequence ENSEMBL: ENSMUSP00000045812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000042556]
Predicted Effect probably benign
Transcript: ENSMUST00000000384
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000042556
AA Change: L84S

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045812
Gene: ENSMUSG00000032834
AA Change: L84S

DomainStartEndE-ValueType
WD40 43 83 1.47e2 SMART
WD40 86 123 1.78e1 SMART
WD40 133 172 5.35e-1 SMART
WD40 177 216 8.29e-1 SMART
low complexity region 239 254 N/A INTRINSIC
WD40 273 316 1.9e2 SMART
WD40 319 359 4.44e0 SMART
WD40 362 401 7.44e-8 SMART
WD40 404 443 3.87e-6 SMART
WD40 446 487 5.7e1 SMART
WD40 490 529 1.28e-11 SMART
WD40 533 571 9.94e-1 SMART
WD40 594 633 4.95e0 SMART
WD40 692 729 2.21e1 SMART
Pfam:Utp12 771 875 9.4e-25 PFAM
low complexity region 890 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,166,070 S185G possibly damaging Het
Adgra1 G A 7: 139,875,685 E410K possibly damaging Het
Aox2 A T 1: 58,322,834 N733I probably damaging Het
Bola3 T A 6: 83,349,298 Y24N probably benign Het
Cntn6 G A 6: 104,726,237 V135I probably benign Het
Eif2s3y A T Y: 1,020,030 M353L probably benign Het
Ercc8 C A 13: 108,160,714 P53T probably damaging Het
Gan A G 8: 117,183,526 K65E probably damaging Het
Gm1110 T C 9: 26,881,043 E597G probably benign Het
Gm15448 T A 7: 3,822,687 R394S probably damaging Het
Gsdmc4 T A 15: 63,902,060 H81L probably benign Het
Hs2st1 T A 3: 144,465,138 N91I probably damaging Het
Olfr391-ps A G 11: 73,799,107 S217P possibly damaging Het
Olfr57 A T 10: 79,035,053 I86F probably damaging Het
Pgr T C 9: 8,901,818 S451P possibly damaging Het
Rab1a T A 11: 20,223,068 probably null Het
Secisbp2 T C 13: 51,670,879 S388P probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sybu T C 15: 44,746,356 K172R probably damaging Het
Topbp1 C T 9: 103,342,140 A1197V probably benign Het
Ttf1 T A 2: 29,065,383 V253D possibly damaging Het
Ugt2a2 A T 5: 87,474,629 V160E probably damaging Het
Vmn1r81 G T 7: 12,260,037 Q215K probably damaging Het
Zfp653 A G 9: 22,065,730 L147P probably damaging Het
Other mutations in Pwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Pwp2 APN 10 78179007 missense probably damaging 1.00
IGL02163:Pwp2 APN 10 78178285 missense possibly damaging 0.82
IGL02280:Pwp2 APN 10 78184100 missense probably damaging 0.99
IGL02558:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02560:Pwp2 APN 10 78179065 missense probably damaging 1.00
IGL02583:Pwp2 APN 10 78181083 missense probably benign
IGL02612:Pwp2 APN 10 78182994 missense probably damaging 0.97
PIT4283001:Pwp2 UTSW 10 78185087 start codon destroyed probably null 1.00
PIT4449001:Pwp2 UTSW 10 78178470 missense probably benign 0.38
R0573:Pwp2 UTSW 10 78182686 missense probably benign 0.37
R1835:Pwp2 UTSW 10 78179091 missense probably damaging 1.00
R2097:Pwp2 UTSW 10 78177742 splice site probably benign
R2251:Pwp2 UTSW 10 78181088 missense probably benign 0.04
R4909:Pwp2 UTSW 10 78182494 missense possibly damaging 0.51
R4950:Pwp2 UTSW 10 78183006 missense probably benign 0.00
R4970:Pwp2 UTSW 10 78173693 missense possibly damaging 0.95
R5015:Pwp2 UTSW 10 78182693 missense probably benign 0.23
R5355:Pwp2 UTSW 10 78175544 missense possibly damaging 0.94
R5390:Pwp2 UTSW 10 78177771 missense possibly damaging 0.63
R5416:Pwp2 UTSW 10 78183001 missense probably damaging 1.00
R5841:Pwp2 UTSW 10 78172118 missense probably benign 0.00
R5928:Pwp2 UTSW 10 78182456 missense probably damaging 0.98
R6495:Pwp2 UTSW 10 78177127 missense probably damaging 1.00
R6771:Pwp2 UTSW 10 78182388 splice site probably null
R6848:Pwp2 UTSW 10 78184293 intron probably null
R6897:Pwp2 UTSW 10 78172083 missense probably damaging 1.00
R7060:Pwp2 UTSW 10 78173250 intron probably null
R7269:Pwp2 UTSW 10 78176336 missense probably benign 0.30
R7367:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7368:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7394:Pwp2 UTSW 10 78182480 missense probably damaging 1.00
R7728:Pwp2 UTSW 10 78178561 missense probably benign 0.00
R7838:Pwp2 UTSW 10 78182944 critical splice donor site probably null
R7898:Pwp2 UTSW 10 78173406 missense probably damaging 1.00
R7921:Pwp2 UTSW 10 78182944 critical splice donor site probably null
R7981:Pwp2 UTSW 10 78173406 missense probably damaging 1.00
R8072:Pwp2 UTSW 10 78172096 missense possibly damaging 0.82
Z1177:Pwp2 UTSW 10 78171974 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACGCATTGAACTCTCGCTTC -3'
(R):5'- AGGGTCAAGTTCAGCTTCATAG -3'

Sequencing Primer
(F):5'- AATGTTGCCCTTTGTGACAACG -3'
(R):5'- GCTTCATAGCACAGGTTCCAG -3'
Posted On2015-02-05