Incidental Mutation 'R2968:Mrgprb5'
ID263315
Institutional Source Beutler Lab
Gene Symbol Mrgprb5
Ensembl Gene ENSMUSG00000070551
Gene NameMAS-related GPR, member B5
SynonymsMrgB5
MMRRC Submission 040524-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2968 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48167983-48169019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48168569 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 139 (R139S)
Ref Sequence ENSEMBL: ENSMUSP00000091953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094389]
Predicted Effect probably damaging
Transcript: ENSMUST00000094389
AA Change: R139S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091953
Gene: ENSMUSG00000070551
AA Change: R139S

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 217 1.4e-8 PFAM
Pfam:7tm_1 47 210 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,715,811 F149S possibly damaging Het
Abcb1b T A 5: 8,861,485 I1113N probably damaging Het
Arhgap12 A T 18: 6,111,732 S211T probably damaging Het
Celsr3 G T 9: 108,832,191 C1412F probably damaging Het
Cnga3 A G 1: 37,261,078 Y331C probably damaging Het
Cntln T A 4: 84,957,267 S313T probably benign Het
Ddx54 T A 5: 120,618,629 D134E probably damaging Het
Dennd4c A G 4: 86,781,644 D244G possibly damaging Het
Dsg3 A T 18: 20,525,225 T298S possibly damaging Het
Dusp1 A T 17: 26,507,705 F128I probably damaging Het
Fam83g T A 11: 61,703,478 S613T probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Ighv8-12 C T 12: 115,647,950 R118Q probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Olfr65 T C 7: 103,907,312 V291A probably benign Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Plxna1 A G 6: 89,342,608 S572P probably damaging Het
Serpina3n C T 12: 104,409,074 T135M probably benign Het
Spink11 A T 18: 44,195,710 F24I possibly damaging Het
Tes A G 6: 17,096,234 T74A probably benign Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Wdr75 A G 1: 45,817,341 D508G probably damaging Het
Other mutations in Mrgprb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mrgprb5 APN 7 48168384 missense probably damaging 1.00
IGL01662:Mrgprb5 APN 7 48168424 missense probably benign 0.02
IGL01752:Mrgprb5 APN 7 48168667 missense probably benign 0.22
IGL02117:Mrgprb5 APN 7 48168994 utr 5 prime probably benign
IGL02866:Mrgprb5 APN 7 48168166 missense probably damaging 0.99
IGL03382:Mrgprb5 APN 7 48168694 missense probably benign 0.01
R0545:Mrgprb5 UTSW 7 48168885 missense probably benign 0.08
R1389:Mrgprb5 UTSW 7 48168330 missense probably damaging 1.00
R1939:Mrgprb5 UTSW 7 48168938 missense probably benign 0.00
R2277:Mrgprb5 UTSW 7 48168831 missense probably damaging 1.00
R2367:Mrgprb5 UTSW 7 48168599 nonsense probably null
R2912:Mrgprb5 UTSW 7 48168067 missense probably benign
R2969:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2970:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R3499:Mrgprb5 UTSW 7 48168913 missense probably benign 0.04
R3828:Mrgprb5 UTSW 7 48168091 missense probably benign 0.01
R4590:Mrgprb5 UTSW 7 48168061 missense probably benign 0.16
R4719:Mrgprb5 UTSW 7 48168778 missense probably damaging 1.00
R5263:Mrgprb5 UTSW 7 48168189 missense probably damaging 0.99
R5264:Mrgprb5 UTSW 7 48168048 missense probably benign 0.10
R5644:Mrgprb5 UTSW 7 48168207 missense probably benign 0.00
R6485:Mrgprb5 UTSW 7 48168777 missense probably damaging 0.99
R6713:Mrgprb5 UTSW 7 48168789 missense probably damaging 0.98
R7112:Mrgprb5 UTSW 7 48168907 missense probably benign
R7176:Mrgprb5 UTSW 7 48168311 missense possibly damaging 0.68
R7446:Mrgprb5 UTSW 7 48168504 missense possibly damaging 0.65
R7640:Mrgprb5 UTSW 7 48168259 missense probably benign 0.00
R7831:Mrgprb5 UTSW 7 48168249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCATCTTGACCAACAGGGC -3'
(R):5'- GCTTGTGCTGATTTCTTGCAAC -3'

Sequencing Primer
(F):5'- TTGACCAACAGGGCCAGGC -3'
(R):5'- AACTTTGCACTCAGATTTTAGGTTCC -3'
Posted On2015-02-05