Incidental Mutation 'R3033:Bahd1'
ID263334
Institutional Source Beutler Lab
Gene Symbol Bahd1
Ensembl Gene ENSMUSG00000040007
Gene Namebromo adjacent homology domain containing 1
SynonymsLOC228536
MMRRC Submission 040549-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3033 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118900377-118924528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118916406 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 169 (P169S)
Ref Sequence ENSEMBL: ENSMUSP00000118998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036578] [ENSMUST00000151162]
Predicted Effect probably benign
Transcript: ENSMUST00000036578
AA Change: P169S

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043130
Gene: ENSMUSG00000040007
AA Change: P169S

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 564 579 N/A INTRINSIC
BAH 616 771 1.17e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151162
AA Change: P169S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118998
Gene: ENSMUSG00000040007
AA Change: P169S

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,694,211 D591G probably benign Het
Aqp4 T A 18: 15,393,560 E288V possibly damaging Het
Astn2 T C 4: 65,644,706 Y894C probably damaging Het
Dennd4c AGGAGCTCCTGGAGC AGGAGC 4: 86,825,320 probably benign Het
Dnah6 T C 6: 73,173,350 D810G probably benign Het
Dst T C 1: 34,152,285 I222T probably damaging Het
Eif4g3 A T 4: 138,103,410 T159S probably damaging Het
Ercc5 A G 1: 44,180,574 E1002G possibly damaging Het
Gm5414 T C 15: 101,624,609 E461G probably damaging Het
Heatr5a A T 12: 51,951,038 C359* probably null Het
Ift88 G A 14: 57,478,044 D515N probably damaging Het
Kmt2a A G 9: 44,821,863 probably benign Het
Lypd8 T C 11: 58,384,627 Y63H probably damaging Het
Mcm3 A T 1: 20,808,768 Y594N probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Naip1 T C 13: 100,432,458 M322V probably benign Het
Neurl2 T C 2: 164,833,055 E129G probably benign Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rapgef2 A G 3: 79,074,306 probably null Het
Selenbp1 T C 3: 94,938,040 V149A probably benign Het
Smg9 A G 7: 24,416,524 D280G probably damaging Het
Tlr1 T C 5: 64,925,569 D555G probably damaging Het
Tomm70a G A 16: 57,122,025 G55D probably damaging Het
Tpte T A 8: 22,320,872 S182T possibly damaging Het
Zfp58 T C 13: 67,491,622 E250G probably damaging Het
Other mutations in Bahd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Bahd1 APN 2 118917205 missense probably benign 0.01
IGL02425:Bahd1 APN 2 118919164 missense probably benign 0.00
IGL02548:Bahd1 APN 2 118917045 missense possibly damaging 0.79
IGL03024:Bahd1 APN 2 118916116 missense probably damaging 1.00
R0932:Bahd1 UTSW 2 118915927 missense probably damaging 1.00
R1737:Bahd1 UTSW 2 118915923 missense probably damaging 1.00
R2845:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2846:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2899:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2900:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2966:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2985:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2986:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3017:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3018:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3019:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3020:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3021:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3040:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3431:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3432:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3617:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4319:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4394:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4395:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4418:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4456:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4462:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4484:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R5537:Bahd1 UTSW 2 118915980 missense probably damaging 0.96
R5556:Bahd1 UTSW 2 118916270 missense probably damaging 1.00
R6490:Bahd1 UTSW 2 118917138 missense probably benign 0.01
R6736:Bahd1 UTSW 2 118915975 missense possibly damaging 0.54
R7604:Bahd1 UTSW 2 118916310 missense probably benign
Z1176:Bahd1 UTSW 2 118922403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCGCCTGGAAAACGTG -3'
(R):5'- GGACAGTTCTTGCCGTTGAC -3'

Sequencing Primer
(F):5'- CCAGTGAGGATGCTGGTCTC -3'
(R):5'- TTGACCTTTGGCCGCAG -3'
Posted On2015-02-05