Incidental Mutation 'R0324:Abcd3'
ID26334
Institutional Source Beutler Lab
Gene Symbol Abcd3
Ensembl Gene ENSMUSG00000028127
Gene NameATP-binding cassette, sub-family D (ALD), member 3
SynonymsPMP70, Pxmp1
MMRRC Submission 038534-MU
Accession Numbers

Genbank: NM_008991; MGI: 1349216

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location121758774-121815302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121769167 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 540 (Q540H)
Ref Sequence ENSEMBL: ENSMUSP00000029770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029770] [ENSMUST00000197383] [ENSMUST00000197662]
Predicted Effect probably null
Transcript: ENSMUST00000029770
AA Change: Q540H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029770
Gene: ENSMUSG00000028127
AA Change: Q540H

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
Pfam:ABC_membrane_2 57 338 8.6e-106 PFAM
AAA 465 640 6.88e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196340
Predicted Effect probably null
Transcript: ENSMUST00000197383
AA Change: Q430H
SMART Domains Protein: ENSMUSP00000142387
Gene: ENSMUSG00000028127
AA Change: Q430H

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:ABC_membrane_2 57 277 2.3e-78 PFAM
AAA 355 530 1.1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197662
SMART Domains Protein: ENSMUSP00000143487
Gene: ENSMUSG00000028127

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199084
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show enlarged livers, abnormal bile composition and peroxisome abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Abcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Abcd3 APN 3 121776993 splice site probably benign
IGL00670:Abcd3 APN 3 121775684 missense probably damaging 1.00
IGL02473:Abcd3 APN 3 121769244 missense possibly damaging 0.74
IGL02660:Abcd3 APN 3 121784020 missense probably damaging 1.00
IGL02993:Abcd3 APN 3 121774010 missense probably benign 0.01
IGL03131:Abcd3 APN 3 121781991 splice site probably benign
3-1:Abcd3 UTSW 3 121760300 missense probably benign
R0599:Abcd3 UTSW 3 121765093 missense probably damaging 1.00
R0682:Abcd3 UTSW 3 121769567 missense possibly damaging 0.90
R1109:Abcd3 UTSW 3 121779596 missense probably damaging 1.00
R1453:Abcd3 UTSW 3 121765061 missense probably damaging 1.00
R1544:Abcd3 UTSW 3 121784473 missense probably benign 0.11
R1571:Abcd3 UTSW 3 121792842 missense possibly damaging 0.80
R1779:Abcd3 UTSW 3 121781963 missense probably damaging 1.00
R2429:Abcd3 UTSW 3 121792863 missense probably damaging 1.00
R4326:Abcd3 UTSW 3 121761470 missense probably benign 0.06
R4676:Abcd3 UTSW 3 121774166 missense possibly damaging 0.69
R4830:Abcd3 UTSW 3 121760284 missense probably damaging 1.00
R4929:Abcd3 UTSW 3 121768746 splice site probably null
R4980:Abcd3 UTSW 3 121769268 splice site probably null
R5052:Abcd3 UTSW 3 121769513 critical splice donor site probably null
R5384:Abcd3 UTSW 3 121761410 splice site probably null
R5616:Abcd3 UTSW 3 121772360 missense probably benign 0.00
R5796:Abcd3 UTSW 3 121784498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGATGAGAATACAGCACTGTAGC -3'
(R):5'- AGGGCGGCTTACTAAACCTGAGAG -3'

Sequencing Primer
(F):5'- CTGTAGCAATAGTTGAAACATGCC -3'
(R):5'- TTTATGTTCCTCAGGTAAGACTTTG -3'
Posted On2013-04-16