Incidental Mutation 'R3033:Aqp4'
ID 263359
Institutional Source Beutler Lab
Gene Symbol Aqp4
Ensembl Gene ENSMUSG00000024411
Gene Name aquaporin 4
Synonyms aquaporin-4
MMRRC Submission 040549-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R3033 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 15389394-15403684 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15393560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 288 (E288V)
Ref Sequence ENSEMBL: ENSMUSP00000078088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079081]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000079081
AA Change: E288V

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078088
Gene: ENSMUSG00000024411
AA Change: E288V

DomainStartEndE-ValueType
Pfam:MIP 29 248 8.7e-76 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit decreased urine osmolality associated with reduced water permeability in inner medullary collecting ducts, increased survival rates and reduced brain edema after acute water intoxication and ischemic stroke, aswell as significant hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T C 8: 24,694,211 D591G probably benign Het
Astn2 T C 4: 65,644,706 Y894C probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Dennd4c AGGAGCTCCTGGAGC AGGAGC 4: 86,825,320 probably benign Het
Dnah6 T C 6: 73,173,350 D810G probably benign Het
Dst T C 1: 34,152,285 I222T probably damaging Het
Eif4g3 A T 4: 138,103,410 T159S probably damaging Het
Ercc5 A G 1: 44,180,574 E1002G possibly damaging Het
Gm5414 T C 15: 101,624,609 E461G probably damaging Het
Heatr5a A T 12: 51,951,038 C359* probably null Het
Ift88 G A 14: 57,478,044 D515N probably damaging Het
Kmt2a A G 9: 44,821,863 probably benign Het
Lypd8 T C 11: 58,384,627 Y63H probably damaging Het
Mcm3 A T 1: 20,808,768 Y594N probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Naip1 T C 13: 100,432,458 M322V probably benign Het
Neurl2 T C 2: 164,833,055 E129G probably benign Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rapgef2 A G 3: 79,074,306 probably null Het
Selenbp1 T C 3: 94,938,040 V149A probably benign Het
Smg9 A G 7: 24,416,524 D280G probably damaging Het
Tlr1 T C 5: 64,925,569 D555G probably damaging Het
Tomm70a G A 16: 57,122,025 G55D probably damaging Het
Tpte T A 8: 22,320,872 S182T possibly damaging Het
Zfp58 T C 13: 67,491,622 E250G probably damaging Het
Other mutations in Aqp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Aqp4 APN 18 15393599 missense probably benign 0.01
IGL01700:Aqp4 APN 18 15399865 missense probably benign 0.44
IGL02409:Aqp4 APN 18 15399725 missense probably benign 0.02
IGL02812:Aqp4 APN 18 15397575 splice site probably null
IGL03157:Aqp4 APN 18 15399980 missense probably benign 0.18
IGL03196:Aqp4 APN 18 15393509 missense probably benign 0.19
R0358:Aqp4 UTSW 18 15398245 missense probably benign
R1061:Aqp4 UTSW 18 15398191 missense probably damaging 1.00
R1981:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R1982:Aqp4 UTSW 18 15393551 missense probably damaging 0.98
R2274:Aqp4 UTSW 18 15393480 missense probably benign
R4608:Aqp4 UTSW 18 15398126 missense probably benign 0.25
R4817:Aqp4 UTSW 18 15399758 missense probably damaging 1.00
R4882:Aqp4 UTSW 18 15398254 missense possibly damaging 0.73
R5870:Aqp4 UTSW 18 15399889 missense probably damaging 1.00
R6235:Aqp4 UTSW 18 15398113 missense probably damaging 1.00
R6334:Aqp4 UTSW 18 15393591 missense probably benign
R6856:Aqp4 UTSW 18 15399896 missense possibly damaging 0.88
R7753:Aqp4 UTSW 18 15399976 missense probably benign 0.00
R7839:Aqp4 UTSW 18 15399680 missense possibly damaging 0.51
R8191:Aqp4 UTSW 18 15398165 missense probably benign
R8206:Aqp4 UTSW 18 15393659 missense possibly damaging 0.88
R8759:Aqp4 UTSW 18 15399991 missense probably benign
R9614:Aqp4 UTSW 18 15393630 missense probably benign 0.01
T0970:Aqp4 UTSW 18 15399883 missense probably damaging 1.00
Z1177:Aqp4 UTSW 18 15399881 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTGTGAAGCAAGAAACCCGC -3'
(R):5'- CCTCAGATATATTGGGTTGGACC -3'

Sequencing Primer
(F):5'- ACAAATCTGTTTCCTTAATGGGTGGC -3'
(R):5'- CAATCATGGGCGCTGTGCTG -3'
Posted On 2015-02-05