Incidental Mutation 'R3036:Atg10'
ID263374
Institutional Source Beutler Lab
Gene Symbol Atg10
Ensembl Gene ENSMUSG00000021619
Gene Nameautophagy related 10
Synonyms5330424L23Rik, 5430428K15Rik, APG10, Apg10l, Apg10p
MMRRC Submission 040552-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R3036 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location90935356-91223968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91040898 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 98 (S98P)
Ref Sequence ENSEMBL: ENSMUSP00000022119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022119] [ENSMUST00000224449]
Predicted Effect probably damaging
Transcript: ENSMUST00000022119
AA Change: S98P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022119
Gene: ENSMUSG00000021619
AA Change: S98P

DomainStartEndE-ValueType
Pfam:Autophagy_act_C 95 162 9.1e-19 PFAM
low complexity region 188 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223729
Predicted Effect probably benign
Transcript: ENSMUST00000224449
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes. ATG10 is an E2-like enzyme involved in 2 ubiquitin-like modifications essential for autophagosome formation: ATG12 (MIM 609608)-ATG5 (MIM 604261) conjugation and modification of a soluble form of MAP-LC3 (MAP1LC3A; MIM 601242), a homolog of yeast Apg8, to a membrane-bound form (Nemoto et al., 2003 [PubMed 12890687]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Caskin2 A G 11: 115,806,356 Y189H probably damaging Het
Ces2b A G 8: 104,834,626 I143V possibly damaging Het
Gpr108 A G 17: 57,245,323 V90A probably benign Het
Kcnk18 T A 19: 59,235,062 V213D probably benign Het
Ly6f T C 15: 75,268,787 C20R probably damaging Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mdn1 T C 4: 32,750,013 C4399R probably damaging Het
Myadm A G 7: 3,297,543 T274A probably benign Het
Nol11 A G 11: 107,173,244 S561P possibly damaging Het
Pbld2 T C 10: 63,071,446 S155P probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Sumf1 G A 6: 108,153,191 A214V possibly damaging Het
Teddm1a A G 1: 153,891,910 Y40C probably benign Het
Tgm2 C T 2: 158,124,247 G496S probably benign Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Ttn C A 2: 76,900,616 probably benign Het
Uty G A Y: 1,099,671 R1112* probably null Het
Other mutations in Atg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Atg10 APN 13 91154211 splice site probably benign
IGL03131:Atg10 APN 13 90937293 missense probably null 0.99
R0362:Atg10 UTSW 13 91040990 critical splice acceptor site probably null
R0826:Atg10 UTSW 13 90936586 critical splice donor site probably null
R1593:Atg10 UTSW 13 91154261 missense probably benign 0.02
R2918:Atg10 UTSW 13 91040908 missense probably damaging 1.00
R3012:Atg10 UTSW 13 91154278 missense probably damaging 0.99
R3837:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R3838:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R3839:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R4324:Atg10 UTSW 13 91040966 missense probably damaging 1.00
R6195:Atg10 UTSW 13 91208436 splice site probably null
R6478:Atg10 UTSW 13 90937347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGTGAAACCTTACCTCAAC -3'
(R):5'- CATTTGCAAGGAGAAGCTCTC -3'

Sequencing Primer
(F):5'- TGGTGAAACCTTACCTCAACTACAG -3'
(R):5'- CTCTTTCCATGTGTGCACTTG -3'
Posted On2015-02-05