Incidental Mutation 'R3036:Kcnk18'
ID263378
Institutional Source Beutler Lab
Gene Symbol Kcnk18
Ensembl Gene ENSMUSG00000040901
Gene Namepotassium channel, subfamily K, member 18
SynonymsLOC332396, Tresk, Tresk-2
MMRRC Submission 040552-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3036 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location59219648-59237370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59235062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 213 (V213D)
Ref Sequence ENSEMBL: ENSMUSP00000065713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065204]
Predicted Effect probably benign
Transcript: ENSMUST00000065204
AA Change: V213D

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065713
Gene: ENSMUSG00000040901
AA Change: V213D

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Ion_trans_2 99 168 1e-21 PFAM
Pfam:Ion_trans_2 298 376 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels play a role in many cellular processes including maintenance of the action potential, muscle contraction, hormone secretion, osmotic regulation, and ion flow. This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains and the encoded protein functions as an outward rectifying potassium channel. A mutation in this gene has been found to be associated with migraine with aura.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit altered potassium conductance and neuron electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg10 A G 13: 91,040,898 S98P probably damaging Het
Caskin2 A G 11: 115,806,356 Y189H probably damaging Het
Ces2b A G 8: 104,834,626 I143V possibly damaging Het
Gpr108 A G 17: 57,245,323 V90A probably benign Het
Ly6f T C 15: 75,268,787 C20R probably damaging Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mdn1 T C 4: 32,750,013 C4399R probably damaging Het
Myadm A G 7: 3,297,543 T274A probably benign Het
Nol11 A G 11: 107,173,244 S561P possibly damaging Het
Pbld2 T C 10: 63,071,446 S155P probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Sumf1 G A 6: 108,153,191 A214V possibly damaging Het
Teddm1a A G 1: 153,891,910 Y40C probably benign Het
Tgm2 C T 2: 158,124,247 G496S probably benign Het
Trpm5 G A 7: 143,085,463 T239I probably benign Het
Ttn C A 2: 76,900,616 probably benign Het
Uty G A Y: 1,099,671 R1112* probably null Het
Other mutations in Kcnk18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Kcnk18 APN 19 59235070 missense probably benign 0.23
IGL01460:Kcnk18 APN 19 59219857 missense probably damaging 1.00
IGL02054:Kcnk18 APN 19 59235613 utr 3 prime probably benign
IGL02304:Kcnk18 APN 19 59234863 missense probably damaging 1.00
IGL02499:Kcnk18 APN 19 59235182 missense probably benign 0.10
IGL02527:Kcnk18 APN 19 59235275 missense probably damaging 0.99
IGL03033:Kcnk18 APN 19 59235184 missense probably benign 0.21
cedar UTSW 19 59235341 missense probably damaging 1.00
R1552:Kcnk18 UTSW 19 59235458 missense probably damaging 0.99
R1775:Kcnk18 UTSW 19 59235341 missense probably damaging 1.00
R1913:Kcnk18 UTSW 19 59235058 missense possibly damaging 0.54
R2278:Kcnk18 UTSW 19 59235494 missense probably damaging 1.00
R4478:Kcnk18 UTSW 19 59235244 missense probably damaging 1.00
R4494:Kcnk18 UTSW 19 59234831 missense probably damaging 1.00
R4827:Kcnk18 UTSW 19 59219930 missense probably damaging 0.97
R5393:Kcnk18 UTSW 19 59219839 missense probably damaging 1.00
R6077:Kcnk18 UTSW 19 59235314 missense probably damaging 0.98
R6145:Kcnk18 UTSW 19 59235607 makesense probably null
R6881:Kcnk18 UTSW 19 59219958 missense probably benign
Z1176:Kcnk18 UTSW 19 59234959 missense probably benign 0.39
Z1177:Kcnk18 UTSW 19 59225479 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAATCCCTCTAATGTTCCTGG -3'
(R):5'- GCCCACTTCATCCAGATTGC -3'

Sequencing Primer
(F):5'- AATGTTCCTGGTCCTCACAGACATAG -3'
(R):5'- CACTTCATCCAGATTGCTGAGAATAG -3'
Posted On2015-02-05