Incidental Mutation 'R3154:Tra2a'
ID263397
Institutional Source Beutler Lab
Gene Symbol Tra2a
Ensembl Gene ENSMUSG00000029817
Gene Nametransformer 2 alpha
Synonyms1500010G04Rik, mAWMS1, G430041M01Rik
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.757) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location49243924-49264033 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) C to T at 49245512 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031841] [ENSMUST00000203820] [ENSMUST00000204189]
Predicted Effect unknown
Transcript: ENSMUST00000031841
AA Change: G245D
SMART Domains Protein: ENSMUSP00000031841
Gene: ENSMUSG00000029817
AA Change: G245D

DomainStartEndE-ValueType
low complexity region 29 106 N/A INTRINSIC
RRM 118 191 4.12e-25 SMART
low complexity region 213 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203820
Predicted Effect unknown
Transcript: ENSMUST00000204189
AA Change: G245D
SMART Domains Protein: ENSMUSP00000145039
Gene: ENSMUSG00000029817
AA Change: G245D

DomainStartEndE-ValueType
low complexity region 29 106 N/A INTRINSIC
RRM 118 191 1.8e-27 SMART
low complexity region 214 280 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204818
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transformer 2 homolog family and encodes a protein with several RRM (RNA recognition motif) domains. This phosphorylated nuclear protein binds to specific RNA sequences and plays a role in the regulation of pre-mRNA splicing. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Tra2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Tra2a APN 6 49249098 missense possibly damaging 0.66
IGL03160:Tra2a APN 6 49263864 missense possibly damaging 0.46
IGL03246:Tra2a APN 6 49249085 nonsense probably null
IGL03098:Tra2a UTSW 6 49249035 missense probably damaging 1.00
R0492:Tra2a UTSW 6 49250955 utr 3 prime probably benign
R0544:Tra2a UTSW 6 49250951 utr 3 prime probably benign
R1634:Tra2a UTSW 6 49250957 utr 3 prime probably benign
R2174:Tra2a UTSW 6 49250927 utr 3 prime probably benign
R2571:Tra2a UTSW 6 49252487 utr 3 prime probably benign
R3897:Tra2a UTSW 6 49245542 utr 3 prime probably benign
R4488:Tra2a UTSW 6 49252494 utr 3 prime probably benign
R5358:Tra2a UTSW 6 49251015 utr 3 prime probably benign
R6045:Tra2a UTSW 6 49252464 utr 3 prime probably benign
R7303:Tra2a UTSW 6 49250987 missense unknown
R7450:Tra2a UTSW 6 49250985 nonsense probably null
X0026:Tra2a UTSW 6 49252392 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- ACCAACCACGTTGACAGGTTG -3'
(R):5'- ATTGCAAGGGGAGGTTCCTTC -3'

Sequencing Primer
(F):5'- ACAGGTTGGGCTTAAATGATCC -3'
(R):5'- GGAGGTTCCTTCTCCTCTCTCTTG -3'
Posted On2015-02-05