Incidental Mutation 'R3154:Fancd2'
ID 263399
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene Name Fanconi anemia, complementation group D2
Synonyms 2410150O07Rik
MMRRC Submission 040605-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3154 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 113508643-113573978 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113570230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1394 (S1394G)
Ref Sequence ENSEMBL: ENSMUSP00000144928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035870] [ENSMUST00000036340] [ENSMUST00000125139] [ENSMUST00000204827]
AlphaFold Q80V62
Predicted Effect probably benign
Transcript: ENSMUST00000035870
SMART Domains Protein: ENSMUSP00000035316
Gene: ENSMUSG00000033963

DomainStartEndE-ValueType
Pfam:DUF4563 3 178 1.4e-99 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036340
AA Change: S1407G

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: S1407G

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125139
SMART Domains Protein: ENSMUSP00000121804
Gene: ENSMUSG00000033963

DomainStartEndE-ValueType
Pfam:DUF4563 1 178 5.2e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204827
AA Change: S1394G

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: S1394G

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,282,744 (GRCm39) N200H probably damaging Het
Abca17 T A 17: 24,547,720 (GRCm39) D218V probably damaging Het
Ap1b1 T C 11: 4,973,135 (GRCm39) V326A possibly damaging Het
Bdp1 A T 13: 100,186,322 (GRCm39) V1710E probably damaging Het
Chrna3 C T 9: 54,923,334 (GRCm39) C158Y probably damaging Het
Cnnm3 T A 1: 36,560,303 (GRCm39) S608T probably damaging Het
Cnot1 T C 8: 96,470,906 (GRCm39) E1314G possibly damaging Het
Cobll1 A T 2: 64,937,394 (GRCm39) M406K probably benign Het
Cyp2d34 T C 15: 82,501,767 (GRCm39) K248E probably benign Het
Dcdc2a A C 13: 25,286,340 (GRCm39) I125L probably benign Het
Dgat1 G A 15: 76,386,721 (GRCm39) L439F probably benign Het
Disc1 T A 8: 125,862,043 (GRCm39) S472T probably damaging Het
Dnajb3 C A 1: 88,132,773 (GRCm39) V210F probably benign Het
Fasn A T 11: 120,698,765 (GRCm39) L2475Q probably damaging Het
Fn1 A T 1: 71,632,242 (GRCm39) C2335S probably damaging Het
Gpld1 T C 13: 25,127,603 (GRCm39) S2P unknown Het
Gpld1 G T 13: 25,140,146 (GRCm39) probably null Het
Gsc2 G A 16: 17,732,364 (GRCm39) R137W probably damaging Het
Gsdme T C 6: 50,228,343 (GRCm39) R42G probably damaging Het
Gtf3c5 T C 2: 28,469,548 (GRCm39) T119A probably damaging Het
Hs6st3 T C 14: 120,106,389 (GRCm39) S266P probably damaging Het
Htr2a T C 14: 74,943,262 (GRCm39) F281L probably benign Het
Hus1b T C 13: 31,131,236 (GRCm39) K141R probably benign Het
Ireb2 T C 9: 54,793,230 (GRCm39) probably null Het
Klhdc7a T A 4: 139,693,024 (GRCm39) Y641F probably benign Het
Kri1 T C 9: 21,193,190 (GRCm39) E57G possibly damaging Het
Map4 A G 9: 109,828,860 (GRCm39) T82A probably benign Het
Mthfr T G 4: 148,136,061 (GRCm39) M353R probably benign Het
Mtus2 A G 5: 148,240,083 (GRCm39) probably benign Het
Muc5ac T A 7: 141,346,473 (GRCm39) probably null Het
Myo15a T A 11: 60,370,186 (GRCm39) probably null Het
Nynrin A T 14: 56,101,044 (GRCm39) Q278L possibly damaging Het
Pced1b T G 15: 97,282,423 (GRCm39) probably null Het
Penk T C 4: 4,134,152 (GRCm39) D165G probably damaging Het
Pfkm T A 15: 98,016,090 (GRCm39) V90D probably damaging Het
Pgk2 T A 17: 40,519,134 (GRCm39) D98V probably damaging Het
Psg28 C A 7: 18,160,348 (GRCm39) A283S possibly damaging Het
Rgl3 A G 9: 21,892,070 (GRCm39) L338P probably damaging Het
Rnf126 A T 10: 79,597,465 (GRCm39) I149N probably damaging Het
Ros1 T C 10: 51,927,077 (GRCm39) H2181R probably benign Het
Slc38a11 C T 2: 65,160,679 (GRCm39) C305Y probably damaging Het
Speg T A 1: 75,378,186 (GRCm39) V798E probably damaging Het
Spesp1 G A 9: 62,189,376 (GRCm39) probably benign Het
Styk1 A T 6: 131,286,975 (GRCm39) Y84* probably null Het
Syt2 T C 1: 134,669,599 (GRCm39) L80P possibly damaging Het
Tra2a C T 6: 49,222,446 (GRCm39) probably benign Het
Trim10 T A 17: 37,182,580 (GRCm39) C149S probably damaging Het
Vmn2r38 T C 7: 9,097,689 (GRCm39) T135A probably benign Het
Wipf1 A G 2: 73,267,834 (GRCm39) V188A possibly damaging Het
Yipf2 G A 9: 21,501,197 (GRCm39) A67V probably benign Het
Zfp759 A G 13: 67,286,719 (GRCm39) E96G probably benign Het
Zic3 G A X: 57,076,838 (GRCm39) V100M possibly damaging Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113,541,357 (GRCm39) critical splice donor site probably null
IGL00475:Fancd2 APN 6 113,545,571 (GRCm39) missense probably benign 0.01
IGL01319:Fancd2 APN 6 113,561,860 (GRCm39) missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113,530,713 (GRCm39) missense probably benign 0.00
IGL01373:Fancd2 APN 6 113,530,713 (GRCm39) missense probably benign 0.00
IGL01393:Fancd2 APN 6 113,554,321 (GRCm39) splice site probably benign
IGL01630:Fancd2 APN 6 113,540,085 (GRCm39) missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113,522,072 (GRCm39) missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113,523,601 (GRCm39) missense probably benign 0.05
IGL02029:Fancd2 APN 6 113,547,936 (GRCm39) missense probably benign 0.44
IGL02224:Fancd2 APN 6 113,545,281 (GRCm39) critical splice donor site probably null
IGL02271:Fancd2 APN 6 113,512,720 (GRCm39) splice site probably benign
IGL02352:Fancd2 APN 6 113,540,073 (GRCm39) missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113,540,073 (GRCm39) missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113,526,313 (GRCm39) splice site probably null
IGL02512:Fancd2 APN 6 113,547,904 (GRCm39) missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113,539,422 (GRCm39) missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113,570,278 (GRCm39) missense probably benign 0.00
IGL03090:Fancd2 APN 6 113,514,558 (GRCm39) splice site probably null
IGL03247:Fancd2 APN 6 113,545,169 (GRCm39) missense probably benign 0.03
R0278:Fancd2 UTSW 6 113,525,409 (GRCm39) critical splice donor site probably null
R0401:Fancd2 UTSW 6 113,525,304 (GRCm39) missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113,513,940 (GRCm39) missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113,532,091 (GRCm39) splice site probably benign
R0762:Fancd2 UTSW 6 113,551,619 (GRCm39) missense probably benign 0.20
R0827:Fancd2 UTSW 6 113,563,210 (GRCm39) critical splice donor site probably null
R1225:Fancd2 UTSW 6 113,512,822 (GRCm39) missense probably damaging 0.99
R1576:Fancd2 UTSW 6 113,555,366 (GRCm39) missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113,570,252 (GRCm39) missense probably damaging 0.96
R2079:Fancd2 UTSW 6 113,532,148 (GRCm39) missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113,537,035 (GRCm39) splice site probably benign
R2141:Fancd2 UTSW 6 113,526,282 (GRCm39) missense probably benign 0.00
R2168:Fancd2 UTSW 6 113,568,120 (GRCm39) missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113,551,598 (GRCm39) missense probably benign 0.33
R3016:Fancd2 UTSW 6 113,513,687 (GRCm39) missense probably benign 0.00
R3153:Fancd2 UTSW 6 113,570,230 (GRCm39) missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113,542,165 (GRCm39) missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113,542,165 (GRCm39) missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113,542,165 (GRCm39) missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113,538,677 (GRCm39) missense probably benign 0.00
R4388:Fancd2 UTSW 6 113,533,329 (GRCm39) missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113,549,603 (GRCm39) critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113,562,438 (GRCm39) missense probably benign 0.06
R4832:Fancd2 UTSW 6 113,530,683 (GRCm39) missense probably benign 0.16
R4841:Fancd2 UTSW 6 113,539,391 (GRCm39) missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113,562,434 (GRCm39) missense probably benign 0.03
R5375:Fancd2 UTSW 6 113,545,673 (GRCm39) missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113,537,012 (GRCm39) critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113,525,833 (GRCm39) missense probably benign 0.00
R5871:Fancd2 UTSW 6 113,533,243 (GRCm39) missense probably benign 0.30
R5901:Fancd2 UTSW 6 113,526,326 (GRCm39) missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113,538,672 (GRCm39) missense probably benign
R6026:Fancd2 UTSW 6 113,528,731 (GRCm39) missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113,532,212 (GRCm39) missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113,555,374 (GRCm39) missense probably benign 0.01
R6666:Fancd2 UTSW 6 113,562,470 (GRCm39) missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113,570,288 (GRCm39) missense probably benign 0.00
R6676:Fancd2 UTSW 6 113,514,626 (GRCm39) nonsense probably null
R6762:Fancd2 UTSW 6 113,562,977 (GRCm39) splice site probably null
R6911:Fancd2 UTSW 6 113,525,346 (GRCm39) missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113,547,979 (GRCm39) critical splice donor site probably null
R7091:Fancd2 UTSW 6 113,522,062 (GRCm39) missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113,533,246 (GRCm39) missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113,513,900 (GRCm39) missense probably benign 0.01
R7344:Fancd2 UTSW 6 113,545,670 (GRCm39) missense probably benign 0.09
R7354:Fancd2 UTSW 6 113,572,907 (GRCm39) missense unknown
R7489:Fancd2 UTSW 6 113,541,265 (GRCm39) missense probably benign
R7501:Fancd2 UTSW 6 113,525,364 (GRCm39) missense possibly damaging 0.95
R7504:Fancd2 UTSW 6 113,521,999 (GRCm39) missense probably damaging 1.00
R7992:Fancd2 UTSW 6 113,542,165 (GRCm39) missense probably damaging 1.00
R8027:Fancd2 UTSW 6 113,523,583 (GRCm39) missense probably damaging 1.00
R8487:Fancd2 UTSW 6 113,545,187 (GRCm39) missense probably damaging 1.00
R8509:Fancd2 UTSW 6 113,549,531 (GRCm39) missense probably benign 0.00
R8757:Fancd2 UTSW 6 113,537,054 (GRCm39) missense possibly damaging 0.91
R8960:Fancd2 UTSW 6 113,540,129 (GRCm39) critical splice donor site probably null
R8978:Fancd2 UTSW 6 113,562,507 (GRCm39) splice site probably benign
R9110:Fancd2 UTSW 6 113,512,762 (GRCm39) missense possibly damaging 0.94
R9116:Fancd2 UTSW 6 113,532,180 (GRCm39) missense probably benign 0.00
R9490:Fancd2 UTSW 6 113,555,416 (GRCm39) missense probably damaging 0.98
R9667:Fancd2 UTSW 6 113,530,717 (GRCm39) nonsense probably null
Z1088:Fancd2 UTSW 6 113,558,383 (GRCm39) missense probably benign 0.00
Z1177:Fancd2 UTSW 6 113,521,986 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCTTCCCTGAATGATAGGTCAG -3'
(R):5'- GATCCCAAAGCATTCATGTAAGC -3'

Sequencing Primer
(F):5'- CCCTGAATGATAGGTCAGAGGTTG -3'
(R):5'- TTGGTAGGGAATGGAGATGGGC -3'
Posted On 2015-02-05