Incidental Mutation 'R3154:Hus1b'
ID263423
Institutional Source Beutler Lab
Gene Symbol Hus1b
Ensembl Gene ENSMUSG00000076430
Gene NameHUS1 checkpoint clamp component B
Synonyms
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location30946573-30947759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30947253 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 141 (K141R)
Ref Sequence ENSEMBL: ENSMUSP00000100007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102943] [ENSMUST00000102946]
Predicted Effect probably benign
Transcript: ENSMUST00000021785
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102943
AA Change: K141R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100007
Gene: ENSMUSG00000076430
AA Change: K141R

DomainStartEndE-ValueType
Pfam:Hus1 1 276 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102946
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223216
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is most closely related to HUS1, a component of a cell cycle checkpoint protein complex involved in cell cycle arrest in response to DNA damage. This protein can interact with the check point protein RAD1 but not with RAD9. Overexpression of this protein has been shown to induce cell death, which suggests a related but distinct role of this protein, as compared to the HUS1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Hus1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Hus1b APN 13 30947544 missense probably benign
IGL02058:Hus1b APN 13 30946917 missense probably benign 0.10
R1104:Hus1b UTSW 13 30947696 intron probably benign
R1476:Hus1b UTSW 13 30947001 missense probably benign 0.10
R4551:Hus1b UTSW 13 30947076 missense probably damaging 1.00
R4583:Hus1b UTSW 13 30947518 missense probably damaging 1.00
R5481:Hus1b UTSW 13 30946959 missense probably benign 0.15
R6416:Hus1b UTSW 13 30947205 missense probably damaging 1.00
R6519:Hus1b UTSW 13 30946947 missense probably benign 0.01
R7057:Hus1b UTSW 13 30947550 missense possibly damaging 0.62
R7569:Hus1b UTSW 13 30946864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGCATTTGGAGGATTTCC -3'
(R):5'- GAGCTGATGTCTGAGCATCTG -3'

Sequencing Primer
(F):5'- TTGAGGTTTGCTTCCACC -3'
(R):5'- ATGTCTGAGCATCTGGCCAGAG -3'
Posted On2015-02-05