Mutagenetix > Incidental Mutation

Incidental Mutation 'R3154:Bdp1'

263425

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

040605-MU

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3154 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100049814 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1710 (V1710E)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

AlphaFold

Q571C7

Predicted Effect

probably damaging
Transcript: ENSMUST00000038104
AA Change: V1710E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: V1710E

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099262

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105697

Predicted Effect

probably damaging
Transcript: ENSMUST00000109379
AA Change: V1710E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: V1710E

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,440,824	N200H	probably damaging	Het
Abca17	T	A	17: 24,328,746	D218V	probably damaging	Het
Ap1b1	T	C	11: 5,023,135	V326A	possibly damaging	Het
Chrna3	C	T	9: 55,016,050	C158Y	probably damaging	Het
Cnnm3	T	A	1: 36,521,222	S608T	probably damaging	Het
Cnot1	T	C	8: 95,744,278	E1314G	possibly damaging	Het
Cobll1	A	T	2: 65,107,050	M406K	probably benign	Het
Cyp2d34	T	C	15: 82,617,566	K248E	probably benign	Het
Dcdc2a	A	C	13: 25,102,357	I125L	probably benign	Het
Dgat1	G	A	15: 76,502,521	L439F	probably benign	Het
Disc1	T	A	8: 125,135,304	S472T	probably damaging	Het
Dnajb3	C	A	1: 88,205,051	V210F	probably benign	Het
Fancd2	A	G	6: 113,593,269	S1394G	possibly damaging	Het
Fasn	A	T	11: 120,807,939	L2475Q	probably damaging	Het
Fn1	A	T	1: 71,593,083	C2335S	probably damaging	Het
Gpld1	T	C	13: 24,943,620	S2P	unknown	Het
Gpld1	G	T	13: 24,956,163		probably null	Het
Gsc2	G	A	16: 17,914,500	R137W	probably damaging	Het
Gsdme	T	C	6: 50,251,363	R42G	probably damaging	Het
Gtf3c5	T	C	2: 28,579,536	T119A	probably damaging	Het
Hs6st3	T	C	14: 119,868,977	S266P	probably damaging	Het
Htr2a	T	C	14: 74,705,822	F281L	probably benign	Het
Hus1b	T	C	13: 30,947,253	K141R	probably benign	Het
Ireb2	T	C	9: 54,885,946		probably null	Het
Klhdc7a	T	A	4: 139,965,713	Y641F	probably benign	Het
Kri1	T	C	9: 21,281,894	E57G	possibly damaging	Het
Map4	A	G	9: 109,999,792	T82A	probably benign	Het
Mthfr	T	G	4: 148,051,604	M353R	probably benign	Het
Mtus2	A	G	5: 148,303,273		probably benign	Het
Muc5ac	T	A	7: 141,792,736		probably null	Het
Myo15	T	A	11: 60,479,360		probably null	Het
Nynrin	A	T	14: 55,863,587	Q278L	possibly damaging	Het
Pced1b	T	G	15: 97,384,542		probably null	Het
Penk	T	C	4: 4,134,152	D165G	probably damaging	Het
Pfkm	T	A	15: 98,118,209	V90D	probably damaging	Het
Pgk2	T	A	17: 40,208,243	D98V	probably damaging	Het
Psg28	C	A	7: 18,426,423	A283S	possibly damaging	Het
Rgl3	A	G	9: 21,980,774	L338P	probably damaging	Het
Rnf126	A	T	10: 79,761,631	I149N	probably damaging	Het
Ros1	T	C	10: 52,050,981	H2181R	probably benign	Het
Slc38a11	C	T	2: 65,330,335	C305Y	probably damaging	Het
Speg	T	A	1: 75,401,542	V798E	probably damaging	Het
Spesp1	G	A	9: 62,282,094		probably benign	Het
Styk1	A	T	6: 131,310,012	Y84*	probably null	Het
Syt2	T	C	1: 134,741,861	L80P	possibly damaging	Het
Tra2a	C	T	6: 49,245,512		probably benign	Het
Trim10	T	A	17: 36,871,688	C149S	probably damaging	Het
Vmn2r38	T	C	7: 9,094,690	T135A	probably benign	Het
Wipf1	A	G	2: 73,437,490	V188A	possibly damaging	Het
Yipf2	G	A	9: 21,589,901	A67V	probably benign	Het
Zfp759	A	G	13: 67,138,655	E96G	probably benign	Het
Zic3	G	A	X: 58,031,478	V100M	possibly damaging	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R7999:Bdp1	UTSW	13	100058896	missense	possibly damaging	0.93
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
R8688:Bdp1	UTSW	13	100103799	missense	probably damaging	1.00
R8871:Bdp1	UTSW	13	100049667	missense	probably damaging	1.00
R8976:Bdp1	UTSW	13	100060899	nonsense	probably null
R8987:Bdp1	UTSW	13	100067513	missense	probably benign	0.01
R9157:Bdp1	UTSW	13	100049928	missense	probably benign	0.40
R9437:Bdp1	UTSW	13	100025650	missense	probably benign	0.31
R9612:Bdp1	UTSW	13	100077862	missense	probably benign	0.18
R9679:Bdp1	UTSW	13	100043777	missense	probably damaging	0.98
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATTAAAGGGGTGAAAGTGCC -3'
(R):5'- TTTCGAGTCGAAGAACCCC -3'

Sequencing Primer
(F):5'- ACACAAACTACCTCTTCCATTGTTTC -3'
(R):5'- GAGTCGAAGAACCCCTCTCTC -3'

Posted On

2015-02-05