Incidental Mutation 'R3154:Htr2a'
ID263427
Institutional Source Beutler Lab
Gene Symbol Htr2a
Ensembl Gene ENSMUSG00000034997
Gene Name5-hydroxytryptamine (serotonin) receptor 2A
SynonymsHtr2, 5-HT2A receptor, Htr-2
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location74640840-74709494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74705822 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 281 (F281L)
Ref Sequence ENSEMBL: ENSMUSP00000047774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036653]
Predicted Effect probably benign
Transcript: ENSMUST00000036653
AA Change: F281L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047774
Gene: ENSMUSG00000034997
AA Change: F281L

DomainStartEndE-ValueType
Pfam:7tm_4 81 264 1.2e-9 PFAM
Pfam:7TM_GPCR_Srx 82 289 1e-6 PFAM
Pfam:7TM_GPCR_Srsx 85 395 1.1e-16 PFAM
Pfam:7tm_1 91 380 5.9e-70 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show altered anxiety-related responses and increased vertical activity. Mice homozygous for a different knock-out allele exhibit abnormal enterocyte, Paneth cell and smooth muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Htr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Htr2a APN 14 74706205 missense possibly damaging 0.93
IGL00946:Htr2a APN 14 74706142 nonsense probably null
IGL01660:Htr2a APN 14 74705754 missense probably damaging 1.00
IGL02200:Htr2a APN 14 74706165 missense probably damaging 1.00
IGL02369:Htr2a APN 14 74706282 missense probably benign 0.17
IGL02724:Htr2a APN 14 74645062 missense probably damaging 1.00
IGL02887:Htr2a APN 14 74645143 missense probably benign 0.05
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0117:Htr2a UTSW 14 74645093 missense probably damaging 1.00
R0367:Htr2a UTSW 14 74642209 missense probably damaging 1.00
R0513:Htr2a UTSW 14 74706324 missense probably benign 0.00
R0729:Htr2a UTSW 14 74642147 missense probably benign
R1507:Htr2a UTSW 14 74705979 missense probably damaging 1.00
R1522:Htr2a UTSW 14 74705853 nonsense probably null
R1539:Htr2a UTSW 14 74645168 missense possibly damaging 0.66
R1735:Htr2a UTSW 14 74706128 missense probably damaging 1.00
R1747:Htr2a UTSW 14 74706153 missense probably damaging 1.00
R1854:Htr2a UTSW 14 74705753 missense probably damaging 1.00
R2232:Htr2a UTSW 14 74645029 missense probably damaging 1.00
R2348:Htr2a UTSW 14 74645110 missense probably damaging 1.00
R3401:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4006:Htr2a UTSW 14 74642141 missense probably benign
R4007:Htr2a UTSW 14 74642141 missense probably benign
R4093:Htr2a UTSW 14 74706349 missense probably benign
R4094:Htr2a UTSW 14 74706349 missense probably benign
R4095:Htr2a UTSW 14 74706349 missense probably benign
R4502:Htr2a UTSW 14 74641988 missense probably benign 0.02
R4720:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4932:Htr2a UTSW 14 74642022 missense probably benign
R5651:Htr2a UTSW 14 74705703 missense probably damaging 0.98
R5935:Htr2a UTSW 14 74645090 missense probably damaging 1.00
R6175:Htr2a UTSW 14 74645034 nonsense probably null
R6937:Htr2a UTSW 14 74645164 missense probably damaging 0.98
R7138:Htr2a UTSW 14 74705742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGGAAGGGAGCTGCCTG -3'
(R):5'- TCATTGCAGGATTCTTTGCAGATG -3'

Sequencing Primer
(F):5'- GCTCGCCGATGACAACTTTG -3'
(R):5'- CTTTGCAGATGACGGCCATG -3'
Posted On2015-02-05