Incidental Mutation 'R3154:Dgat1'
ID263429
Institutional Source Beutler Lab
Gene Symbol Dgat1
Ensembl Gene ENSMUSG00000022555
Gene Namediacylglycerol O-acyltransferase 1
SynonymsD15Ertd23e
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76502015-76511953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76502521 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 439 (L439F)
Ref Sequence ENSEMBL: ENSMUSP00000023214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023214] [ENSMUST00000072838] [ENSMUST00000226860] [ENSMUST00000226872] [ENSMUST00000227478] [ENSMUST00000228371] [ENSMUST00000228757] [ENSMUST00000228868] [ENSMUST00000229363]
Predicted Effect probably benign
Transcript: ENSMUST00000023214
AA Change: L439F

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023214
Gene: ENSMUSG00000022555
AA Change: L439F

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 41 57 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
Pfam:MBOAT 162 485 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072838
SMART Domains Protein: ENSMUSP00000072617
Gene: ENSMUSG00000022556

DomainStartEndE-ValueType
HSF 14 118 2.27e-66 SMART
Pfam:Vert_HS_TF 247 414 6e-65 PFAM
Pfam:Vert_HS_TF 412 503 1.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160293
SMART Domains Protein: ENSMUSP00000123779
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
Pfam:MBOAT 41 201 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162813
Predicted Effect probably benign
Transcript: ENSMUST00000226238
Predicted Effect probably benign
Transcript: ENSMUST00000226860
Predicted Effect probably benign
Transcript: ENSMUST00000226872
Predicted Effect probably benign
Transcript: ENSMUST00000227478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227921
Predicted Effect probably benign
Transcript: ENSMUST00000228371
Predicted Effect probably benign
Transcript: ENSMUST00000228688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228720
Predicted Effect probably benign
Transcript: ENSMUST00000228757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228781
Predicted Effect probably benign
Transcript: ENSMUST00000228868
Predicted Effect probably benign
Transcript: ENSMUST00000229363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231035
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an multipass transmembrane protein that functions as a key metabolic enzyme. The encoded protein catalyzes the conversion of diacylglycerol and fatty acyl CoA to triacylglycerol. This enzyme can also transfer acyl CoA to retinol. Activity of this protein may be associated with obesity and other metabolic diseases. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased percent body fat, resistance to diet-induced obesity, altered energy, glucose and triglyceride metabolism, alopecia, hair cycle and skin defects, and a lactation failure associated with impaired mammary gland growth during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pfkm T A 15: 98,118,209 V90D probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Dgat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Dgat1 APN 15 76503041 missense probably damaging 1.00
IGL02713:Dgat1 APN 15 76503534 missense probably damaging 1.00
R0510:Dgat1 UTSW 15 76511567 missense possibly damaging 0.85
R0894:Dgat1 UTSW 15 76502999 missense possibly damaging 0.55
R1525:Dgat1 UTSW 15 76511586 missense probably benign
R1682:Dgat1 UTSW 15 76503019 missense probably benign 0.03
R1740:Dgat1 UTSW 15 76502729 missense probably damaging 1.00
R1817:Dgat1 UTSW 15 76502503 missense probably damaging 1.00
R2352:Dgat1 UTSW 15 76502313 missense possibly damaging 0.66
R3012:Dgat1 UTSW 15 76503393 missense possibly damaging 0.90
R4059:Dgat1 UTSW 15 76504171 missense possibly damaging 0.79
R4593:Dgat1 UTSW 15 76504689 missense probably damaging 1.00
R5503:Dgat1 UTSW 15 76502194 unclassified probably benign
R5818:Dgat1 UTSW 15 76502207 unclassified probably benign
R5984:Dgat1 UTSW 15 76502258 missense probably damaging 1.00
R6228:Dgat1 UTSW 15 76503293 missense possibly damaging 0.89
R7352:Dgat1 UTSW 15 76502824 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGTTCCCTTGGAAGAATCGGC -3'
(R):5'- GCTTGCTCTGCAGACACTTC -3'

Sequencing Primer
(F):5'- TTGGAAGAATCGGCCCACAATC -3'
(R):5'- TATGCTCAGACATGGCAGC -3'
Posted On2015-02-05