Incidental Mutation 'R3154:Pfkm'
ID263432
Institutional Source Beutler Lab
Gene Symbol Pfkm
Ensembl Gene ENSMUSG00000033065
Gene Namephosphofructokinase, muscle
SynonymsPFK-M, Pfk-4, PFK-A, Pfk4, Pfkx
MMRRC Submission 040605-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R3154 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98092589-98132451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98118209 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 90 (V90D)
Ref Sequence ENSEMBL: ENSMUSP00000155453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051226] [ENSMUST00000163507] [ENSMUST00000229280] [ENSMUST00000229344] [ENSMUST00000230445]
Predicted Effect probably damaging
Transcript: ENSMUST00000051226
AA Change: V38D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059801
Gene: ENSMUSG00000033065
AA Change: V38D

DomainStartEndE-ValueType
Pfam:PFK 17 324 1.3e-111 PFAM
Pfam:PFK 402 687 1e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163507
AA Change: V38D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132803
Gene: ENSMUSG00000033065
AA Change: V38D

DomainStartEndE-ValueType
Pfam:PFK 16 326 2.9e-138 PFAM
Pfam:PFK 401 688 1.8e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229280
AA Change: V38D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000229344
AA Change: V90D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230445
AA Change: V38D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three phosphofructokinase isozymes exist in humans: muscle, liver and platelet. These isozymes function as subunits of the mammalian tetramer phosphofructokinase, which catalyzes the phosphorylation of fructose-6-phosphate to fructose-1,6-bisphosphate. Tetramer composition varies depending on tissue type. This gene encodes the muscle-type isozyme. Mutations in this gene have been associated with glycogen storage disease type VII, also known as Tarui disease. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit abnormal glucose homeostasis. Mice homozygous for a knock-out allele exhibit premature death, exercise intolerance, abnormal glucose homeostasis, cardiomegaly, splenomegaly, and abnormal muscle morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Ap1b1 T C 11: 5,023,135 V326A possibly damaging Het
Bdp1 A T 13: 100,049,814 V1710E probably damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Cobll1 A T 2: 65,107,050 M406K probably benign Het
Cyp2d34 T C 15: 82,617,566 K248E probably benign Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Dgat1 G A 15: 76,502,521 L439F probably benign Het
Disc1 T A 8: 125,135,304 S472T probably damaging Het
Dnajb3 C A 1: 88,205,051 V210F probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fasn A T 11: 120,807,939 L2475Q probably damaging Het
Fn1 A T 1: 71,593,083 C2335S probably damaging Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gpld1 G T 13: 24,956,163 probably null Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Gsdme T C 6: 50,251,363 R42G probably damaging Het
Gtf3c5 T C 2: 28,579,536 T119A probably damaging Het
Hs6st3 T C 14: 119,868,977 S266P probably damaging Het
Htr2a T C 14: 74,705,822 F281L probably benign Het
Hus1b T C 13: 30,947,253 K141R probably benign Het
Ireb2 T C 9: 54,885,946 probably null Het
Klhdc7a T A 4: 139,965,713 Y641F probably benign Het
Kri1 T C 9: 21,281,894 E57G possibly damaging Het
Map4 A G 9: 109,999,792 T82A probably benign Het
Mthfr T G 4: 148,051,604 M353R probably benign Het
Mtus2 A G 5: 148,303,273 probably benign Het
Muc5ac T A 7: 141,792,736 probably null Het
Myo15 T A 11: 60,479,360 probably null Het
Nynrin A T 14: 55,863,587 Q278L possibly damaging Het
Pced1b T G 15: 97,384,542 probably null Het
Penk T C 4: 4,134,152 D165G probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Psg28 C A 7: 18,426,423 A283S possibly damaging Het
Rgl3 A G 9: 21,980,774 L338P probably damaging Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Ros1 T C 10: 52,050,981 H2181R probably benign Het
Slc38a11 C T 2: 65,330,335 C305Y probably damaging Het
Speg T A 1: 75,401,542 V798E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Syt2 T C 1: 134,741,861 L80P possibly damaging Het
Tra2a C T 6: 49,245,512 probably benign Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Vmn2r38 T C 7: 9,094,690 T135A probably benign Het
Wipf1 A G 2: 73,437,490 V188A possibly damaging Het
Yipf2 G A 9: 21,589,901 A67V probably benign Het
Zfp759 A G 13: 67,138,655 E96G probably benign Het
Zic3 G A X: 58,031,478 V100M possibly damaging Het
Other mutations in Pfkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Pfkm APN 15 98125594 missense probably benign 0.00
IGL01843:Pfkm APN 15 98129306 missense possibly damaging 0.65
IGL02090:Pfkm APN 15 98123240 critical splice donor site probably null
IGL02624:Pfkm APN 15 98126395 missense probably benign 0.03
IGL02869:Pfkm APN 15 98128242 missense probably damaging 1.00
IGL03102:Pfkm APN 15 98126385 missense possibly damaging 0.86
IGL03164:Pfkm APN 15 98131962 missense probably damaging 1.00
IGL03188:Pfkm APN 15 98123243 splice site probably null
IGL03241:Pfkm APN 15 98123180 missense probably benign 0.02
E0374:Pfkm UTSW 15 98123233 missense probably damaging 1.00
R0379:Pfkm UTSW 15 98126314 missense probably benign 0.01
R0524:Pfkm UTSW 15 98131607 missense probably benign
R0898:Pfkm UTSW 15 98128230 missense probably benign 0.09
R1086:Pfkm UTSW 15 98131665 missense probably benign 0.05
R1698:Pfkm UTSW 15 98128318 missense possibly damaging 0.95
R1886:Pfkm UTSW 15 98127746 missense probably damaging 1.00
R2051:Pfkm UTSW 15 98131692 missense probably benign 0.03
R2102:Pfkm UTSW 15 98129290 missense probably damaging 1.00
R2312:Pfkm UTSW 15 98125575 missense probably damaging 1.00
R3688:Pfkm UTSW 15 98131517 missense probably benign 0.00
R3911:Pfkm UTSW 15 98125047 missense probably benign 0.02
R4999:Pfkm UTSW 15 98128242 missense probably damaging 1.00
R5008:Pfkm UTSW 15 98122689 missense probably benign 0.35
R5027:Pfkm UTSW 15 98119426 missense possibly damaging 0.55
R5178:Pfkm UTSW 15 98131515 missense probably benign
R5617:Pfkm UTSW 15 98122226 missense possibly damaging 0.88
R5891:Pfkm UTSW 15 98122690 nonsense probably null
R6248:Pfkm UTSW 15 98126379 missense probably damaging 1.00
R7079:Pfkm UTSW 15 98095082 missense probably benign 0.31
X0020:Pfkm UTSW 15 98112226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGACCCCTTGACCGAAAC -3'
(R):5'- GGGTCCCAGCATTCTTGTTG -3'

Sequencing Primer
(F):5'- CCTTGACCGAAACTGGGGAG -3'
(R):5'- CCAGCATTCTTGTTGAAGTCACAGTG -3'
Posted On2015-02-05