Incidental Mutation 'R3155:Adh1'
ID263451
Institutional Source Beutler Lab
Gene Symbol Adh1
Ensembl Gene ENSMUSG00000074207
Gene Namealcohol dehydrogenase 1 (class I)
Synonymsclass I alcohol dehydrogenase, ADH-AA, Adh1tl, Adh-1e, Adh-1t, Adh-1-t, Adh-1, Adh1-t, Adh1-e
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138260991-138290698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138280489 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 79 (E79G)
Ref Sequence ENSEMBL: ENSMUSP00000004232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004232] [ENSMUST00000159159]
Predicted Effect probably damaging
Transcript: ENSMUST00000004232
AA Change: E79G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000004232
Gene: ENSMUSG00000074207
AA Change: E79G

DomainStartEndE-ValueType
Pfam:ADH_N 34 161 1.3e-25 PFAM
Pfam:ADH_zinc_N 203 337 3.6e-27 PFAM
Pfam:ADH_zinc_N_2 236 369 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162032
Meta Mutation Damage Score 0.2513 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired metabolism of (and sensitivity to) ethanol and retinol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Adh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Adh1 APN 3 138282499 missense probably benign 0.00
IGL00510:Adh1 APN 3 138289907 missense probably damaging 1.00
IGL01326:Adh1 APN 3 138286911 missense probably damaging 1.00
IGL01662:Adh1 APN 3 138282751 missense possibly damaging 0.96
IGL02090:Adh1 APN 3 138282785 missense possibly damaging 0.95
PIT4687001:Adh1 UTSW 3 138289835 missense probably damaging 1.00
R0413:Adh1 UTSW 3 138280432 missense probably benign 0.00
R0882:Adh1 UTSW 3 138286797 missense possibly damaging 0.65
R1426:Adh1 UTSW 3 138286795 missense probably damaging 1.00
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1901:Adh1 UTSW 3 138288797 missense probably benign 0.00
R2056:Adh1 UTSW 3 138286915 missense probably damaging 1.00
R2095:Adh1 UTSW 3 138282796 missense probably damaging 1.00
R3752:Adh1 UTSW 3 138288794 missense probably benign
R3795:Adh1 UTSW 3 138279765 missense possibly damaging 0.85
R4351:Adh1 UTSW 3 138280497 missense probably benign 0.21
R4698:Adh1 UTSW 3 138282513 missense probably benign 0.05
R4747:Adh1 UTSW 3 138288881 missense probably damaging 1.00
R5626:Adh1 UTSW 3 138280410 missense probably benign 0.04
R6014:Adh1 UTSW 3 138286798 missense probably benign 0.00
R6060:Adh1 UTSW 3 138286783 missense probably damaging 1.00
R6225:Adh1 UTSW 3 138289804 missense probably benign 0.04
R6637:Adh1 UTSW 3 138282470 nonsense probably null
R7129:Adh1 UTSW 3 138280474 missense probably damaging 0.98
R7288:Adh1 UTSW 3 138282732 missense probably benign
R7291:Adh1 UTSW 3 138282808 missense probably damaging 1.00
R7367:Adh1 UTSW 3 138290551 missense probably benign 0.04
R7453:Adh1 UTSW 3 138289941 critical splice donor site probably null
R7613:Adh1 UTSW 3 138286831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAAGGATTGTTAGGAAGCCCC -3'
(R):5'- TGGATGTAGCACGACTGAGG -3'

Sequencing Primer
(F):5'- TTGTTAGGAAGCCCCTCAGAAGC -3'
(R):5'- TAGCACGACTGAGGCATGC -3'
Posted On2015-02-05