Incidental Mutation 'R3155:Aco1'
ID263453
Institutional Source Beutler Lab
Gene Symbol Aco1
Ensembl Gene ENSMUSG00000028405
Gene Nameaconitase 1
SynonymsIrp1, Irebp, Aco-1
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40143081-40198338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40182915 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 487 (V487A)
Ref Sequence ENSEMBL: ENSMUSP00000100038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102973]
Predicted Effect probably damaging
Transcript: ENSMUST00000102973
AA Change: V487A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100038
Gene: ENSMUSG00000028405
AA Change: V487A

DomainStartEndE-ValueType
Pfam:Aconitase 54 564 4.5e-180 PFAM
Pfam:Aconitase_C 692 821 1e-48 PFAM
Meta Mutation Damage Score 0.7056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a member of the aconitase/IPM isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Depending on iron levels in the cytosol, the encoded protein can function as either an aconitase enzyme or as an mRNA binding protein. When cellular iron levels are high, the encoded protein functions as an aconitase, an essential enzyme in the TCA cycle that catalyzes the conversion of citrate to isocitrate. When cellular iron levels are low, the encoded protein regulates iron uptake and utilization by binding to iron-responsive elements in the untranslated regions of mRNAs for genes involved in iron metabolism. Disruption of this gene is associated with pulmonary hypertension and polycythemia. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Aco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Aco1 APN 4 40180290 critical splice donor site probably null
IGL01081:Aco1 APN 4 40197576 missense probably benign
IGL01364:Aco1 APN 4 40181380 splice site probably null
IGL01733:Aco1 APN 4 40175738 splice site probably benign
IGL02232:Aco1 APN 4 40175996 missense probably damaging 1.00
IGL02709:Aco1 APN 4 40180199 missense possibly damaging 0.86
IGL03164:Aco1 APN 4 40167116 missense probably benign 0.30
IGL03208:Aco1 APN 4 40186424 missense possibly damaging 0.55
IGL03324:Aco1 APN 4 40186363 missense probably benign
IGL03353:Aco1 APN 4 40175893 missense probably damaging 0.99
R0002:Aco1 UTSW 4 40176649 splice site probably benign
R0486:Aco1 UTSW 4 40177783 missense probably damaging 1.00
R0636:Aco1 UTSW 4 40175697 missense probably damaging 1.00
R1344:Aco1 UTSW 4 40179008 missense probably damaging 1.00
R1844:Aco1 UTSW 4 40197566 missense probably benign 0.00
R1889:Aco1 UTSW 4 40164607 critical splice acceptor site probably null
R1932:Aco1 UTSW 4 40176499 missense probably damaging 1.00
R1959:Aco1 UTSW 4 40167193 critical splice donor site probably null
R1965:Aco1 UTSW 4 40175730 missense probably damaging 1.00
R1983:Aco1 UTSW 4 40175845 missense probably benign 0.37
R2072:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2073:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2074:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R4595:Aco1 UTSW 4 40167139 missense probably benign 0.43
R4999:Aco1 UTSW 4 40176507 missense probably damaging 1.00
R5131:Aco1 UTSW 4 40163797 missense probably benign
R5354:Aco1 UTSW 4 40180290 critical splice donor site probably null
R5380:Aco1 UTSW 4 40177848 missense probably damaging 1.00
R6352:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6353:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6380:Aco1 UTSW 4 40185028 missense probably benign 0.02
R6540:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6751:Aco1 UTSW 4 40188330 intron probably null
R6760:Aco1 UTSW 4 40180210 nonsense probably null
R6833:Aco1 UTSW 4 40164747 missense probably benign 0.00
R6834:Aco1 UTSW 4 40164747 missense probably benign 0.00
R7019:Aco1 UTSW 4 40186376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGATCTGCCAGTCAAGAAGTG -3'
(R):5'- GCCCAGGGTTCACTCTTGTATG -3'

Sequencing Primer
(F):5'- TCTGCCAGTCAAGAAGTGTAACTG -3'
(R):5'- ATGTATGATGGATGGGCCCC -3'
Posted On2015-02-05