Mutagenetix > Incidental Mutations

Incidental Mutation 'R3155:Aco1'

263453

Institutional Source

Beutler Lab

Gene Symbol

Aco1

Ensembl Gene

ENSMUSG00000028405

Gene Name

aconitase 1

Synonyms

Irp1, Irebp, Aco-1

MMRRC Submission

040606-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R3155 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40143081-40198338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40182915 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 487 (V487A)

Ref Sequence

ENSEMBL: ENSMUSP00000100038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102973]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102973
AA Change: V487A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000100038
Gene: ENSMUSG00000028405
AA Change: V487A

Domain	Start	End	E-Value	Type
Pfam:Aconitase	54	564	4.5e-180	PFAM
Pfam:Aconitase_C	692	821	1e-48	PFAM

Meta Mutation Damage Score

0.342

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: This gene encodes a member of the aconitase/IPM isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Depending on iron levels in the cytosol, the encoded protein can function as either an aconitase enzyme or as an mRNA binding protein. When cellular iron levels are high, the encoded protein functions as an aconitase, an essential enzyme in the TCA cycle that catalyzes the conversion of citrate to isocitrate. When cellular iron levels are low, the encoded protein regulates iron uptake and utilization by binding to iron-responsive elements in the untranslated regions of mRNAs for genes involved in iron metabolism. Disruption of this gene is associated with pulmonary hypertension and polycythemia. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no obvious phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	C	1: 85,931,383		probably benign	Het
Adh1	A	G	3: 138,280,489	E79G	probably damaging	Het
Aebp1	A	G	11: 5,871,425	N608S	probably benign	Het
Ahctf1	G	A	1: 179,755,583	R43C	probably damaging	Het
Ahnak	A	T	19: 9,010,177	I2942L	possibly damaging	Het
Anxa9	A	T	3: 95,302,405	D134E	probably benign	Het
Ccdc14	A	G	16: 34,723,852	D860G	probably damaging	Het
Cdhr3	T	A	12: 33,049,153	I480F	possibly damaging	Het
Cldn34a	C	T	X: 152,563,844	H171Y	probably benign	Het
Cyp2d9	T	A	15: 82,452,642		probably null	Het
Dmbt1	T	A	7: 131,050,157	Y376*	probably null	Het
Fancm	T	C	12: 65,116,421	I1453T	probably benign	Het
Fbxw11	A	G	11: 32,739,244	I456V	possibly damaging	Het
Fut2	A	T	7: 45,650,667	L227Q	probably damaging	Het
Gbp5	T	C	3: 142,503,127		probably null	Het
Glrp1	C	A	1: 88,503,254	Q131H	unknown	Het
Gm6871	T	C	7: 41,573,655	N3S	probably benign	Het
H2-Eb1	C	A	17: 34,314,374	T190K	probably damaging	Het
Kdr	T	A	5: 75,968,405	I194F	probably benign	Het
Klhdc7a	A	G	4: 139,967,189	V149A	probably benign	Het
Lrit3	A	G	3: 129,791,395	F238S	probably benign	Het
Map10	A	T	8: 125,671,574	I569F	possibly damaging	Het
Myh6	A	G	14: 54,944,668	I1761T	probably damaging	Het
Npc1l1	A	C	11: 6,221,840	D874E	probably benign	Het
Olfr726	T	C	14: 50,084,525	D52G	probably benign	Het
Olfr895	T	A	9: 38,268,540	M1K	probably null	Het
Pawr	A	G	10: 108,409,509	T193A	probably benign	Het
Ppp2r3a	T	C	9: 101,212,360	K255E	possibly damaging	Het
Rbp3	A	T	14: 33,957,114	K1006N	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rin2	A	G	2: 145,860,851	K489R	probably benign	Het
Rlf	A	G	4: 121,149,332	V817A	probably damaging	Het
Rusc1	T	C	3: 89,091,731	D248G	probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Stk4	T	A	2: 164,151,743	M98K	probably benign	Het
Taf15	T	A	11: 83,502,773	H307Q	probably benign	Het
Urgcp	A	T	11: 5,716,327	F670L	probably damaging	Het
Vmn2r76	T	C	7: 86,225,751	T673A	probably damaging	Het
Zfp324	G	A	7: 12,968,890	M60I	probably damaging	Het

Other mutations in Aco1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00813:Aco1	APN	4	40180290	critical splice donor site	probably null
IGL01081:Aco1	APN	4	40197576	missense	probably benign
IGL01364:Aco1	APN	4	40181380	splice site	probably null
IGL01733:Aco1	APN	4	40175738	splice site	probably benign
IGL02232:Aco1	APN	4	40175996	missense	probably damaging	1.00
IGL02709:Aco1	APN	4	40180199	missense	possibly damaging	0.86
IGL03164:Aco1	APN	4	40167116	missense	probably benign	0.30
IGL03208:Aco1	APN	4	40186424	missense	possibly damaging	0.55
IGL03324:Aco1	APN	4	40186363	missense	probably benign
IGL03353:Aco1	APN	4	40175893	missense	probably damaging	0.99
R0002:Aco1	UTSW	4	40176649	splice site	probably benign
R0486:Aco1	UTSW	4	40177783	missense	probably damaging	1.00
R0636:Aco1	UTSW	4	40175697	missense	probably damaging	1.00
R1344:Aco1	UTSW	4	40179008	missense	probably damaging	1.00
R1844:Aco1	UTSW	4	40197566	missense	probably benign	0.00
R1889:Aco1	UTSW	4	40164607	critical splice acceptor site	probably null
R1932:Aco1	UTSW	4	40176499	missense	probably damaging	1.00
R1959:Aco1	UTSW	4	40167193	critical splice donor site	probably null
R1965:Aco1	UTSW	4	40175730	missense	probably damaging	1.00
R1983:Aco1	UTSW	4	40175845	missense	probably benign	0.37
R2072:Aco1	UTSW	4	40183605	missense	probably damaging	1.00
R2073:Aco1	UTSW	4	40183605	missense	probably damaging	1.00
R2074:Aco1	UTSW	4	40183605	missense	probably damaging	1.00
R4595:Aco1	UTSW	4	40167139	missense	probably benign	0.43
R4999:Aco1	UTSW	4	40176507	missense	probably damaging	1.00
R5131:Aco1	UTSW	4	40163797	missense	probably benign
R5354:Aco1	UTSW	4	40180290	critical splice donor site	probably null
R5380:Aco1	UTSW	4	40177848	missense	probably damaging	1.00
R6352:Aco1	UTSW	4	40186367	missense	probably benign	0.10
R6353:Aco1	UTSW	4	40186367	missense	probably benign	0.10
R6380:Aco1	UTSW	4	40185028	missense	probably benign	0.02
R6540:Aco1	UTSW	4	40186367	missense	probably benign	0.10
R6751:Aco1	UTSW	4	40188330	intron	probably null
R6760:Aco1	UTSW	4	40180210	nonsense	probably null
R6833:Aco1	UTSW	4	40164747	missense	probably benign	0.00
R6834:Aco1	UTSW	4	40164747	missense	probably benign	0.00
R7019:Aco1	UTSW	4	40186376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGATCTGCCAGTCAAGAAGTG -3'
(R):5'- GCCCAGGGTTCACTCTTGTATG -3'

Sequencing Primer
(F):5'- TCTGCCAGTCAAGAAGTGTAACTG -3'
(R):5'- ATGTATGATGGATGGGCCCC -3'

Posted On

2015-02-05