Incidental Mutation 'R3155:Fbxw11'
ID263470
Institutional Source Beutler Lab
Gene Symbol Fbxw11
Ensembl Gene ENSMUSG00000020271
Gene NameF-box and WD-40 domain protein 11
SynonymsHOS, 2310065A07Rik, Fbxw1b, BTRC2, BTRCP2
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R3155 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location32642724-32746816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32739244 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 456 (I456V)
Ref Sequence ENSEMBL: ENSMUSP00000090893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076383] [ENSMUST00000093205] [ENSMUST00000109366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076383
AA Change: I477V

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075721
Gene: ENSMUSG00000020271
AA Change: I477V

DomainStartEndE-ValueType
Beta-TrCP_D 98 137 5.48e-26 SMART
FBOX 149 188 5.08e-6 SMART
WD40 250 287 6.89e-3 SMART
WD40 290 327 3.78e-9 SMART
WD40 330 367 7.73e-6 SMART
WD40 373 410 9.67e-7 SMART
WD40 413 450 3.93e-7 SMART
WD40 453 490 8.42e-7 SMART
WD40 502 539 2.48e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093205
AA Change: I456V

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090893
Gene: ENSMUSG00000020271
AA Change: I456V

DomainStartEndE-ValueType
Beta-TrCP_D 77 116 5.48e-26 SMART
FBOX 128 167 5.08e-6 SMART
WD40 229 266 6.89e-3 SMART
WD40 269 306 3.78e-9 SMART
WD40 309 346 7.73e-6 SMART
WD40 352 389 9.67e-7 SMART
WD40 392 429 3.93e-7 SMART
WD40 432 469 8.42e-7 SMART
WD40 481 518 2.48e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109366
AA Change: I443V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104991
Gene: ENSMUSG00000020271
AA Change: I443V

DomainStartEndE-ValueType
Beta-TrCP_D 64 103 5.48e-26 SMART
FBOX 115 154 5.08e-6 SMART
WD40 216 253 6.89e-3 SMART
WD40 256 293 3.78e-9 SMART
WD40 296 333 7.73e-6 SMART
WD40 339 376 9.67e-7 SMART
WD40 379 416 3.93e-7 SMART
WD40 419 456 8.42e-7 SMART
WD40 468 505 2.48e-4 SMART
Meta Mutation Damage Score 0.374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cldn34a C T X: 152,563,844 H171Y probably benign Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Fbxw11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Fbxw11 APN 11 32722101 missense possibly damaging 0.94
IGL01828:Fbxw11 APN 11 32720505 missense probably damaging 1.00
PIT4651001:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
R0311:Fbxw11 UTSW 11 32722083 missense probably benign 0.00
R0331:Fbxw11 UTSW 11 32711895 missense probably damaging 0.99
R0597:Fbxw11 UTSW 11 32720496 missense probably damaging 1.00
R0989:Fbxw11 UTSW 11 32735149 missense probably benign 0.17
R1175:Fbxw11 UTSW 11 32711922 missense probably damaging 0.96
R1327:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
R1589:Fbxw11 UTSW 11 32733612 missense probably damaging 1.00
R4084:Fbxw11 UTSW 11 32739248 missense probably damaging 1.00
R4610:Fbxw11 UTSW 11 32711859 missense possibly damaging 0.48
R4677:Fbxw11 UTSW 11 32742535 nonsense probably null
R4694:Fbxw11 UTSW 11 32642820 unclassified probably benign
R4946:Fbxw11 UTSW 11 32739226 missense probably damaging 1.00
R5027:Fbxw11 UTSW 11 32652811 intron probably benign
R5345:Fbxw11 UTSW 11 32738471 missense probably damaging 1.00
R5459:Fbxw11 UTSW 11 32739191 missense possibly damaging 0.85
R5802:Fbxw11 UTSW 11 32711790 missense probably benign 0.18
R5820:Fbxw11 UTSW 11 32735374 missense probably damaging 1.00
R6181:Fbxw11 UTSW 11 32742575 missense probably benign
R6365:Fbxw11 UTSW 11 32720623 missense possibly damaging 0.75
R6948:Fbxw11 UTSW 11 32742597 missense probably damaging 0.98
R7251:Fbxw11 UTSW 11 32731370 missense probably benign 0.00
R7475:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
X0064:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGAATAGACAGACTTACCTGC -3'
(R):5'- GTCTTCAAGTGCCTGGCTAC -3'

Sequencing Primer
(F):5'- CTGCACAGAACAGGGGTACAC -3'
(R):5'- CACGATTGAGGCAGGCTTTAC -3'
Posted On2015-02-05