Mutagenetix > Incidental Mutations

Incidental Mutation 'R3155:Ahnak'

263481

Institutional Source

Beutler Lab

Gene Symbol

Ahnak

Ensembl Gene

ENSMUSG00000069833

Gene Name

AHNAK nucleoprotein (desmoyokin)

Synonyms

1110004P15Rik, 2310047C17Rik, DY6

MMRRC Submission

040606-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.402) question?

Stock #

R3155 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8989284-9076919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9010177 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 2942 (I2942L)

Ref Sequence

ENSEMBL: ENSMUSP00000090633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]

Predicted Effect

probably benign
Transcript: ENSMUST00000092955

SMART Domains

Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092956
AA Change: I2942L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: I2942L

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART
internal_repeat_2	163	1515	5.22e-182	PROSPERO
internal_repeat_1	224	2314	N/A	PROSPERO
internal_repeat_2	1532	3028	5.22e-182	PROSPERO
internal_repeat_1	2660	5095	N/A	PROSPERO
low complexity region	5336	5353	N/A	INTRINSIC
low complexity region	5493	5504	N/A	INTRINSIC
low complexity region	5580	5600	N/A	INTRINSIC
low complexity region	5620	5636	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933407L21Rik	T	C	1: 85,931,383		probably benign	Het
Aco1	T	C	4: 40,182,915	V487A	probably damaging	Het
Adh1	A	G	3: 138,280,489	E79G	probably damaging	Het
Aebp1	A	G	11: 5,871,425	N608S	probably benign	Het
Ahctf1	G	A	1: 179,755,583	R43C	probably damaging	Het
Anxa9	A	T	3: 95,302,405	D134E	probably benign	Het
Ccdc14	A	G	16: 34,723,852	D860G	probably damaging	Het
Cdhr3	T	A	12: 33,049,153	I480F	possibly damaging	Het
Cldn34a	C	T	X: 152,563,844	H171Y	probably benign	Het
Cyp2d9	T	A	15: 82,452,642		probably null	Het
Dmbt1	T	A	7: 131,050,157	Y376*	probably null	Het
Fancm	T	C	12: 65,116,421	I1453T	probably benign	Het
Fbxw11	A	G	11: 32,739,244	I456V	possibly damaging	Het
Fut2	A	T	7: 45,650,667	L227Q	probably damaging	Het
Gbp5	T	C	3: 142,503,127		probably null	Het
Glrp1	C	A	1: 88,503,254	Q131H	unknown	Het
Gm6871	T	C	7: 41,573,655	N3S	probably benign	Het
H2-Eb1	C	A	17: 34,314,374	T190K	probably damaging	Het
Kdr	T	A	5: 75,968,405	I194F	probably benign	Het
Klhdc7a	A	G	4: 139,967,189	V149A	probably benign	Het
Lrit3	A	G	3: 129,791,395	F238S	probably benign	Het
Map10	A	T	8: 125,671,574	I569F	possibly damaging	Het
Myh6	A	G	14: 54,944,668	I1761T	probably damaging	Het
Npc1l1	A	C	11: 6,221,840	D874E	probably benign	Het
Olfr726	T	C	14: 50,084,525	D52G	probably benign	Het
Olfr895	T	A	9: 38,268,540	M1K	probably null	Het
Pawr	A	G	10: 108,409,509	T193A	probably benign	Het
Ppp2r3a	T	C	9: 101,212,360	K255E	possibly damaging	Het
Rbp3	A	T	14: 33,957,114	K1006N	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rin2	A	G	2: 145,860,851	K489R	probably benign	Het
Rlf	A	G	4: 121,149,332	V817A	probably damaging	Het
Rusc1	T	C	3: 89,091,731	D248G	probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Stk4	T	A	2: 164,151,743	M98K	probably benign	Het
Taf15	T	A	11: 83,502,773	H307Q	probably benign	Het
Urgcp	A	T	11: 5,716,327	F670L	probably damaging	Het
Vmn2r76	T	C	7: 86,225,751	T673A	probably damaging	Het
Zfp324	G	A	7: 12,968,890	M60I	probably damaging	Het

Other mutations in Ahnak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Ahnak	APN	19	9007223	missense	probably damaging	0.99
IGL00509:Ahnak	APN	19	9009951	missense	possibly damaging	0.94
IGL00539:Ahnak	APN	19	9007908	missense	possibly damaging	0.50
IGL00558:Ahnak	APN	19	9004307	missense	possibly damaging	0.93
IGL00567:Ahnak	APN	19	9013383	missense	probably benign	0.24
IGL00706:Ahnak	APN	19	9013730	nonsense	probably null
IGL00807:Ahnak	APN	19	9008522	missense	possibly damaging	0.92
IGL00870:Ahnak	APN	19	9013698	missense	probably damaging	1.00
IGL01101:Ahnak	APN	19	9012887	intron	probably benign
IGL01118:Ahnak	APN	19	9012578	missense	probably damaging	1.00
IGL01288:Ahnak	APN	19	9002494	missense	possibly damaging	0.94
IGL01324:Ahnak	APN	19	9003032	missense	probably damaging	1.00
IGL01341:Ahnak	APN	19	9011703	missense	probably benign
IGL01541:Ahnak	APN	19	9007879	missense	possibly damaging	0.95
IGL01580:Ahnak	APN	19	9002839	missense	probably benign	0.02
IGL01595:Ahnak	APN	19	9003501	nonsense	probably null
IGL01746:Ahnak	APN	19	9004912	missense	possibly damaging	0.89
IGL01766:Ahnak	APN	19	9000118	missense	unknown
IGL01821:Ahnak	APN	19	9012118	missense	probably benign
IGL01913:Ahnak	APN	19	9006064	nonsense	probably null
IGL01934:Ahnak	APN	19	9002657	missense	probably damaging	1.00
IGL01940:Ahnak	APN	19	9006557	missense	probably benign	0.14
IGL01958:Ahnak	APN	19	9014909	missense	possibly damaging	0.59
IGL02145:Ahnak	APN	19	9002855	missense	probably benign	0.11
IGL02246:Ahnak	APN	19	9008268	missense	probably damaging	1.00
IGL02282:Ahnak	APN	19	9005987	missense	probably damaging	1.00
IGL02428:Ahnak	APN	19	9014833	missense	possibly damaging	0.83
IGL02442:Ahnak	APN	19	9004016	missense	probably damaging	1.00
IGL02474:Ahnak	APN	19	9004933	missense	probably benign	0.13
IGL02483:Ahnak	APN	19	9003308	missense	probably benign	0.01
IGL02616:Ahnak	APN	19	9005627	missense	probably benign	0.03
IGL02630:Ahnak	APN	19	9012077	missense	probably damaging	1.00
IGL02690:Ahnak	APN	19	9012584	nonsense	probably null
IGL02717:Ahnak	APN	19	9002387	missense	probably benign	0.00
IGL02721:Ahnak	APN	19	9009707	missense	probably benign	0.07
IGL02737:Ahnak	APN	19	9004593	missense	probably benign	0.17
IGL02850:Ahnak	APN	19	9002596	missense	probably benign	0.00
IGL03071:Ahnak	APN	19	9011918	missense	possibly damaging	0.63
IGL03072:Ahnak	APN	19	9006508	missense	probably benign	0.11
IGL03094:Ahnak	APN	19	9003547	missense	possibly damaging	0.64
IGL03140:Ahnak	APN	19	9005212	intron	probably benign
IGL03176:Ahnak	APN	19	9008166	missense	possibly damaging	0.56
IGL03176:Ahnak	APN	19	9002449	missense	probably damaging	1.00
IGL03189:Ahnak	APN	19	9011239	missense	possibly damaging	0.65
IGL03357:Ahnak	APN	19	9009325	intron	probably benign
IGL03371:Ahnak	APN	19	9004228	missense	possibly damaging	0.91
Eskimo	UTSW	19	9009574	missense	probably benign	0.31
Nanook	UTSW	19	9003231	missense	probably benign	0.42
Netsilik	UTSW	19	9002321	missense	probably benign	0.00
IGL03097:Ahnak	UTSW	19	9002387	missense	probably benign	0.00
PIT4403001:Ahnak	UTSW	19	9006176	missense	possibly damaging	0.87
R0054:Ahnak	UTSW	19	9012056	missense	probably damaging	1.00
R0094:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R0110:Ahnak	UTSW	19	9018232	nonsense	probably null
R0141:Ahnak	UTSW	19	9006680	missense	probably damaging	1.00
R0166:Ahnak	UTSW	19	9005725	missense	probably damaging	1.00
R0309:Ahnak	UTSW	19	9002495	missense	probably damaging	1.00
R0368:Ahnak	UTSW	19	9008350	nonsense	probably null
R0386:Ahnak	UTSW	19	9011144	missense	possibly damaging	0.94
R0401:Ahnak	UTSW	19	9015116	missense	probably benign	0.24
R0415:Ahnak	UTSW	19	9012871	intron	probably benign
R0463:Ahnak	UTSW	19	9009407	intron	probably benign
R0469:Ahnak	UTSW	19	9018232	nonsense	probably null
R0470:Ahnak	UTSW	19	9008967	missense	probably benign	0.29
R0487:Ahnak	UTSW	19	9007151	missense	probably benign	0.00
R0487:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R0499:Ahnak	UTSW	19	9000264	splice site	probably benign
R0506:Ahnak	UTSW	19	9009128	missense	probably damaging	1.00
R0510:Ahnak	UTSW	19	9018232	nonsense	probably null
R0557:Ahnak	UTSW	19	9001944	missense	probably benign	0.10
R0570:Ahnak	UTSW	19	9013698	missense	probably damaging	1.00
R0610:Ahnak	UTSW	19	9007878	missense	probably benign	0.08
R0646:Ahnak	UTSW	19	9013402	nonsense	probably null
R0659:Ahnak	UTSW	19	9015002	missense	possibly damaging	0.60
R0791:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0792:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0840:Ahnak	UTSW	19	9005063	missense	probably damaging	1.00
R0847:Ahnak	UTSW	19	9006433	nonsense	probably null
R0941:Ahnak	UTSW	19	9009914	missense	probably damaging	1.00
R0962:Ahnak	UTSW	19	9012848	intron	probably benign
R1017:Ahnak	UTSW	19	9010543	missense	probably damaging	0.99
R1037:Ahnak	UTSW	19	9007618	missense	probably benign	0.27
R1085:Ahnak	UTSW	19	9013125	missense	possibly damaging	0.50
R1113:Ahnak	UTSW	19	9005620	missense	probably benign	0.29
R1140:Ahnak	UTSW	19	9004245	missense	probably damaging	1.00
R1158:Ahnak	UTSW	19	9013926	missense	probably benign	0.00
R1218:Ahnak	UTSW	19	9015619	missense	probably damaging	1.00
R1225:Ahnak	UTSW	19	9002883	missense	probably damaging	1.00
R1245:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R1421:Ahnak	UTSW	19	9015631	missense	possibly damaging	0.95
R1447:Ahnak	UTSW	19	9007082	missense	probably damaging	0.98
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1471:Ahnak	UTSW	19	9012932	intron	probably benign
R1507:Ahnak	UTSW	19	9010077	missense	probably damaging	1.00
R1521:Ahnak	UTSW	19	9004728	missense	probably benign	0.11
R1568:Ahnak	UTSW	19	9002375	missense	probably damaging	0.98
R1569:Ahnak	UTSW	19	9004094	missense	possibly damaging	0.78
R1616:Ahnak	UTSW	19	9008987	missense	possibly damaging	0.94
R1638:Ahnak	UTSW	19	9009449	missense	probably benign	0.01
R1680:Ahnak	UTSW	19	9009963	missense	probably benign	0.05
R1713:Ahnak	UTSW	19	9011809	missense	possibly damaging	0.95
R1722:Ahnak	UTSW	19	9010655	missense	probably damaging	0.99
R1771:Ahnak	UTSW	19	9013753	missense	probably benign	0.24
R1795:Ahnak	UTSW	19	9002438	missense	possibly damaging	0.79
R1823:Ahnak	UTSW	19	9004905	missense	probably damaging	0.99
R1842:Ahnak	UTSW	19	9005867	missense	probably damaging	0.99
R1854:Ahnak	UTSW	19	9013832	missense	possibly damaging	0.61
R1856:Ahnak	UTSW	19	9002048	missense	possibly damaging	0.86
R1886:Ahnak	UTSW	19	9015979	missense	probably damaging	0.98
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1912:Ahnak	UTSW	19	9017881	missense	probably damaging	1.00
R1913:Ahnak	UTSW	19	9007922	missense	probably damaging	0.99
R1942:Ahnak	UTSW	19	9015083	missense	probably damaging	0.98
R1987:Ahnak	UTSW	19	9015251	missense	probably damaging	1.00
R2006:Ahnak	UTSW	19	9007075	missense	probably damaging	1.00
R2013:Ahnak	UTSW	19	9014573	missense	probably damaging	0.98
R2014:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R2047:Ahnak	UTSW	19	9014300	missense	possibly damaging	0.67
R2048:Ahnak	UTSW	19	9007056	missense	probably damaging	0.99
R2060:Ahnak	UTSW	19	9008041	missense	probably benign	0.08
R2083:Ahnak	UTSW	19	9011557	missense	probably damaging	1.00
R2157:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R2167:Ahnak	UTSW	19	9011494	nonsense	probably null
R2208:Ahnak	UTSW	19	9017732	missense	probably benign	0.00
R2224:Ahnak	UTSW	19	9012991	intron	probably benign
R2268:Ahnak	UTSW	19	9010574	missense	possibly damaging	0.66
R2420:Ahnak	UTSW	19	9009256	missense	possibly damaging	0.89
R2426:Ahnak	UTSW	19	9002851	missense	possibly damaging	0.81
R2910:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2911:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2981:Ahnak	UTSW	19	9000148	missense	probably damaging	0.97
R3151:Ahnak	UTSW	19	9009944	missense	probably benign	0.12
R3422:Ahnak	UTSW	19	9005708	missense	probably benign	0.39
R3422:Ahnak	UTSW	19	9006752	missense	probably benign	0.05
R3430:Ahnak	UTSW	19	9006958	missense	probably benign	0.42
R3433:Ahnak	UTSW	19	9009994	missense	probably benign	0.01
R3711:Ahnak	UTSW	19	9007898	missense	probably benign
R3723:Ahnak	UTSW	19	9016853	missense	possibly damaging	0.79
R3775:Ahnak	UTSW	19	9009023	missense	possibly damaging	0.91
R3858:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3859:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3922:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3924:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3926:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R4026:Ahnak	UTSW	19	9011299	missense	probably damaging	0.97
R4051:Ahnak	UTSW	19	9014327	missense	probably damaging	1.00
R4209:Ahnak	UTSW	19	9002600	missense	probably damaging	1.00
R4234:Ahnak	UTSW	19	9000786	nonsense	probably null
R4237:Ahnak	UTSW	19	9001783	missense	probably benign	0.02
R4285:Ahnak	UTSW	19	9016839	nonsense	probably null
R4331:Ahnak	UTSW	19	9015820	missense	probably damaging	1.00
R4342:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R4430:Ahnak	UTSW	19	9003040	missense	probably benign	0.00
R4554:Ahnak	UTSW	19	9014930	missense	probably damaging	1.00
R4602:Ahnak	UTSW	19	9010825	missense	possibly damaging	0.66
R4612:Ahnak	UTSW	19	9003724	missense	probably benign	0.44
R4655:Ahnak	UTSW	19	9008701	missense	probably damaging	1.00
R4656:Ahnak	UTSW	19	9004855	missense	possibly damaging	0.80
R4700:Ahnak	UTSW	19	9004681	missense	probably benign	0.02
R4704:Ahnak	UTSW	19	9012258	intron	probably benign
R4704:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R4705:Ahnak	UTSW	19	9016906	missense	probably benign	0.07
R4707:Ahnak	UTSW	19	9016735	missense	probably benign	0.03
R4732:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4733:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4778:Ahnak	UTSW	19	9011975	missense	possibly damaging	0.79
R4782:Ahnak	UTSW	19	9012499	intron	probably benign
R4832:Ahnak	UTSW	19	9012460	intron	probably benign
R4882:Ahnak	UTSW	19	9005897	missense	probably damaging	0.98
R4884:Ahnak	UTSW	19	9012754	intron	probably benign
R4895:Ahnak	UTSW	19	9017441	missense	probably benign	0.43
R4930:Ahnak	UTSW	19	9010967	missense	possibly damaging	0.79
R4951:Ahnak	UTSW	19	9017835	missense	probably damaging	1.00
R4968:Ahnak	UTSW	19	9015100	missense	probably damaging	1.00
R5026:Ahnak	UTSW	19	9010631	missense	possibly damaging	0.46
R5050:Ahnak	UTSW	19	9012458	intron	probably benign
R5073:Ahnak	UTSW	19	9003231	missense	probably benign	0.42
R5110:Ahnak	UTSW	19	9014759	missense	probably damaging	1.00
R5119:Ahnak	UTSW	19	9013644	missense	probably benign	0.00
R5128:Ahnak	UTSW	19	9017087	missense	probably damaging	1.00
R5139:Ahnak	UTSW	19	9004655	missense	probably damaging	1.00
R5150:Ahnak	UTSW	19	9010904	missense	possibly damaging	0.46
R5151:Ahnak	UTSW	19	9017569	missense	probably benign	0.03
R5165:Ahnak	UTSW	19	9015665	missense	possibly damaging	0.95
R5236:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R5361:Ahnak	UTSW	19	9015341	missense	possibly damaging	0.92
R5366:Ahnak	UTSW	19	9016735	missense	possibly damaging	0.65
R5387:Ahnak	UTSW	19	9003691	missense	probably damaging	1.00
R5396:Ahnak	UTSW	19	9007175	missense	probably damaging	0.99
R5583:Ahnak	UTSW	19	9006917	missense	probably damaging	0.99
R5587:Ahnak	UTSW	19	9009476	missense	possibly damaging	0.88
R5620:Ahnak	UTSW	19	9013094	nonsense	probably null
R5643:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5644:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5657:Ahnak	UTSW	19	9014615	missense	probably damaging	0.99
R5688:Ahnak	UTSW	19	9002519	missense	probably benign	0.01
R5702:Ahnak	UTSW	19	9001840	missense	probably damaging	1.00
R5727:Ahnak	UTSW	19	9016747	missense	probably damaging	0.99
R5730:Ahnak	UTSW	19	9010253	missense	possibly damaging	0.81
R5755:Ahnak	UTSW	19	9001732	missense	probably benign	0.06
R5760:Ahnak	UTSW	19	9013562	missense	probably damaging	1.00
R5789:Ahnak	UTSW	19	9002321	missense	probably benign	0.00
R5790:Ahnak	UTSW	19	9015248	missense	probably damaging	0.99
R5795:Ahnak	UTSW	19	9012382	nonsense	probably null
R5808:Ahnak	UTSW	19	9010235	missense	possibly damaging	0.91
R5867:Ahnak	UTSW	19	9010052	missense	probably damaging	0.99
R5878:Ahnak	UTSW	19	9008342	missense	probably damaging	1.00
R5898:Ahnak	UTSW	19	9013767	missense	possibly damaging	0.63
R5898:Ahnak	UTSW	19	9018211	missense	probably damaging	1.00
R5912:Ahnak	UTSW	19	9011903	missense	probably damaging	0.99
R5935:Ahnak	UTSW	19	9015182	missense	possibly damaging	0.91
R5969:Ahnak	UTSW	19	9016585	missense	probably damaging	1.00
R5988:Ahnak	UTSW	19	9009347	intron	probably benign
R6000:Ahnak	UTSW	19	9013111	nonsense	probably null
R6005:Ahnak	UTSW	19	9015161	missense	possibly damaging	0.61
R6101:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6105:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6116:Ahnak	UTSW	19	9012963	intron	probably benign
R6209:Ahnak	UTSW	19	9012566	missense	probably damaging	1.00
R6240:Ahnak	UTSW	19	9013583	missense	probably damaging	1.00
R6255:Ahnak	UTSW	19	9008025	missense	possibly damaging	0.95
R6263:Ahnak	UTSW	19	9018277	missense	probably benign	0.03
R6287:Ahnak	UTSW	19	9015003	missense	probably benign	0.02
R6296:Ahnak	UTSW	19	9003305	missense	probably damaging	0.99
R6315:Ahnak	UTSW	19	9006626	missense	probably damaging	0.99
R6328:Ahnak	UTSW	19	9007148	missense	probably benign	0.11
R6331:Ahnak	UTSW	19	9006625	missense	probably benign	0.18
R6355:Ahnak	UTSW	19	9008762	missense	probably benign	0.02
R6409:Ahnak	UTSW	19	9009574	missense	probably benign	0.31
R6567:Ahnak	UTSW	19	9008806	missense	probably benign	0.27
R6572:Ahnak	UTSW	19	9007976	missense	probably damaging	0.99
R6574:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R6590:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6620:Ahnak	UTSW	19	9015310	missense	possibly damaging	0.95
R6690:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6731:Ahnak	UTSW	19	9011562	missense	possibly damaging	0.85
R6756:Ahnak	UTSW	19	9007561	missense	possibly damaging	0.59
R6846:Ahnak	UTSW	19	9011857	missense	possibly damaging	0.66
R6854:Ahnak	UTSW	19	9015235	missense	probably damaging	1.00
R6857:Ahnak	UTSW	19	9037168	nonsense	probably null
R6863:Ahnak	UTSW	19	9012365	intron	probably benign
R6876:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R6958:Ahnak	UTSW	19	9015215	missense	possibly damaging	0.88
R7126:Ahnak	UTSW	19	9002359	missense	possibly damaging	0.61
R7181:Ahnak	UTSW	19	9013488	missense	probably damaging	1.00
R7183:Ahnak	UTSW	19	9017668	missense	probably damaging	1.00
R7202:Ahnak	UTSW	19	9017799	missense	probably damaging	1.00
R7235:Ahnak	UTSW	19	9012488	missense	unknown
R7241:Ahnak	UTSW	19	9009031	missense	possibly damaging	0.65
R7269:Ahnak	UTSW	19	9006617	missense	probably damaging	1.00
R7311:Ahnak	UTSW	19	9002143	missense	probably benign	0.04
R7311:Ahnak	UTSW	19	9009827	missense	possibly damaging	0.56
R7329:Ahnak	UTSW	19	9001792	missense	probably damaging	0.99
R7339:Ahnak	UTSW	19	9008165	missense	possibly damaging	0.75
R7390:Ahnak	UTSW	19	9003205	missense	probably benign	0.02
R7400:Ahnak	UTSW	19	9014613	missense	probably damaging	0.99
R7444:Ahnak	UTSW	19	9007423	missense	probably benign	0.08
R7483:Ahnak	UTSW	19	9004822	missense	probably damaging	1.00
R7498:Ahnak	UTSW	19	9012019	missense	probably benign	0.14
R7521:Ahnak	UTSW	19	9002351	missense	possibly damaging	0.89
R7522:Ahnak	UTSW	19	9002322	missense	probably benign	0.01
R7552:Ahnak	UTSW	19	9006824	missense	probably benign	0.18
R7563:Ahnak	UTSW	19	9011165	missense	probably damaging	0.99
R7565:Ahnak	UTSW	19	9016156	missense	probably benign	0.05
R7571:Ahnak	UTSW	19	9000786	nonsense	probably null
R7583:Ahnak	UTSW	19	9006093	missense	possibly damaging	0.90
R7600:Ahnak	UTSW	19	9004574	missense	possibly damaging	0.89
X0021:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
X0027:Ahnak	UTSW	19	9012037	missense	probably damaging	1.00
Z1088:Ahnak	UTSW	19	9016082	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCAAGGTGAAAATGCCCAAGTTC -3'
(R):5'- GGCATTTTCAGTTTGGGACCC -3'

Sequencing Primer
(F):5'- GTTCAGCATGCCTGGCTTCAAG -3'
(R):5'- TTCCTTCAGGACCATGAACATC -3'

Posted On

2015-02-05