Incidental Mutation 'R3155:Cldn34a'
ID263482
Institutional Source Beutler Lab
Gene Symbol Cldn34a
Ensembl Gene ENSMUSG00000091863
Gene Nameclaudin 34A
SynonymsGm7157
MMRRC Submission 040606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.017) question?
Stock #R3155 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location152563334-152563969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152563844 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 171 (H171Y)
Ref Sequence ENSEMBL: ENSMUSP00000128513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164764]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118211
Predicted Effect probably benign
Transcript: ENSMUST00000164764
AA Change: H171Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128513
Gene: ENSMUSG00000091863
AA Change: H171Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Aco1 T C 4: 40,182,915 V487A probably damaging Het
Adh1 A G 3: 138,280,489 E79G probably damaging Het
Aebp1 A G 11: 5,871,425 N608S probably benign Het
Ahctf1 G A 1: 179,755,583 R43C probably damaging Het
Ahnak A T 19: 9,010,177 I2942L possibly damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Ccdc14 A G 16: 34,723,852 D860G probably damaging Het
Cdhr3 T A 12: 33,049,153 I480F possibly damaging Het
Cyp2d9 T A 15: 82,452,642 probably null Het
Dmbt1 T A 7: 131,050,157 Y376* probably null Het
Fancm T C 12: 65,116,421 I1453T probably benign Het
Fbxw11 A G 11: 32,739,244 I456V possibly damaging Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gbp5 T C 3: 142,503,127 probably null Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
H2-Eb1 C A 17: 34,314,374 T190K probably damaging Het
Kdr T A 5: 75,968,405 I194F probably benign Het
Klhdc7a A G 4: 139,967,189 V149A probably benign Het
Lrit3 A G 3: 129,791,395 F238S probably benign Het
Map10 A T 8: 125,671,574 I569F possibly damaging Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Npc1l1 A C 11: 6,221,840 D874E probably benign Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr895 T A 9: 38,268,540 M1K probably null Het
Pawr A G 10: 108,409,509 T193A probably benign Het
Ppp2r3a T C 9: 101,212,360 K255E possibly damaging Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,860,851 K489R probably benign Het
Rlf A G 4: 121,149,332 V817A probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Stk4 T A 2: 164,151,743 M98K probably benign Het
Taf15 T A 11: 83,502,773 H307Q probably benign Het
Urgcp A T 11: 5,716,327 F670L probably damaging Het
Vmn2r76 T C 7: 86,225,751 T673A probably damaging Het
Zfp324 G A 7: 12,968,890 M60I probably damaging Het
Other mutations in Cldn34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1990:Cldn34a UTSW X 152563845 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CCTGATGTTGACTACCAGCC -3'
(R):5'- AATCCTTGCTGAACCAACATG -3'

Sequencing Primer
(F):5'- GCTCTTAGAAATGTGTACACGG -3'
(R):5'- GCTGAACCAACATGAAGTTTTTG -3'
Posted On2015-02-05