Incidental Mutation 'R3156:2310007B03Rik'
ID263485
Institutional Source Beutler Lab
Gene Symbol 2310007B03Rik
Ensembl Gene ENSMUSG00000034159
Gene NameRIKEN cDNA 2310007B03 gene
Synonyms
MMRRC Submission 040607-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3156 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93151349-93160948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93160042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 30 (I30F)
Ref Sequence ENSEMBL: ENSMUSP00000115971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043718] [ENSMUST00000143419]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043718
AA Change: I30F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035332
Gene: ENSMUSG00000034159
AA Change: I30F

DomainStartEndE-ValueType
Mab-21 71 372 2.18e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143419
AA Change: I30F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115971
Gene: ENSMUSG00000034159
AA Change: I30F

DomainStartEndE-ValueType
Mab-21 71 372 2.18e-52 SMART
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,383 probably benign Het
Adra2b T C 2: 127,363,650 L29P probably damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Atad1 A T 19: 32,706,955 N14K probably benign Het
Cbl T C 9: 44,158,850 I533M possibly damaging Het
Cdca2 T C 14: 67,698,163 N368D possibly damaging Het
Cfap45 A T 1: 172,545,724 N543Y possibly damaging Het
Col4a2 T A 8: 11,313,414 probably benign Het
Dis3l T C 9: 64,311,750 T633A probably benign Het
Dnah5 G A 15: 28,438,091 probably benign Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gcnt2 T C 13: 40,861,178 V275A probably benign Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Hmgcs1 C T 13: 119,705,078 T402I probably benign Het
Hps6 A G 19: 46,003,741 D39G probably damaging Het
Mycbp2 A T 14: 103,208,743 probably benign Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Neo1 T C 9: 58,888,979 probably null Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr845 A G 9: 19,339,424 probably null Het
Patj A G 4: 98,674,228 E1478G probably damaging Het
Paxbp1 T C 16: 91,035,990 T304A probably benign Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Secisbp2 A G 13: 51,662,675 T288A probably benign Het
Setbp1 A G 18: 78,859,303 V383A probably benign Het
Sez6 T A 11: 77,953,779 S143T possibly damaging Het
Slc5a9 A T 4: 111,890,224 I322N possibly damaging Het
Szt2 A G 4: 118,402,819 probably null Het
Tex2 A G 11: 106,533,869 probably null Het
Tonsl A T 15: 76,639,521 L64Q probably damaging Het
Triml2 A G 8: 43,187,679 N191D probably benign Het
Trpc1 C T 9: 95,721,132 probably null Het
Yeats4 C T 10: 117,222,281 V22I probably benign Het
Other mutations in 2310007B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:2310007B03Rik APN 1 93152072 missense probably damaging 0.98
R0018:2310007B03Rik UTSW 1 93154605 missense probably benign 0.00
R0115:2310007B03Rik UTSW 1 93159725 missense possibly damaging 0.70
R0467:2310007B03Rik UTSW 1 93153044 missense probably damaging 1.00
R1452:2310007B03Rik UTSW 1 93152939 missense probably damaging 1.00
R1938:2310007B03Rik UTSW 1 93152008 makesense probably null
R4740:2310007B03Rik UTSW 1 93156168 missense probably benign 0.01
R5260:2310007B03Rik UTSW 1 93159978 missense probably damaging 0.99
R5283:2310007B03Rik UTSW 1 93159853 missense probably benign 0.02
R5645:2310007B03Rik UTSW 1 93152946 missense probably damaging 1.00
R6380:2310007B03Rik UTSW 1 93160891 splice site probably null
R6738:2310007B03Rik UTSW 1 93159985 missense probably benign 0.30
R7184:2310007B03Rik UTSW 1 93154515 missense probably benign 0.00
R7227:2310007B03Rik UTSW 1 93152014 missense probably benign 0.00
R7562:2310007B03Rik UTSW 1 93159967 missense probably damaging 1.00
R8001:2310007B03Rik UTSW 1 93154599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTGACTCCTCGATCAG -3'
(R):5'- TCACTCTGGAACTCTGCCTG -3'

Sequencing Primer
(F):5'- GGAGAGCCTCCGAATCCAC -3'
(R):5'- AACTCTGCCTGTGGAGAGCTG -3'
Posted On2015-02-05